BLASTN 2.2.21 [Jun-14-2009] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= X69337 X69337.1 E.coli dps gene for binding protein (504 letters) Database: xc 460 sequences; 5,103,728 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE012145 AE008922 Xanthomonas campestris pv. campestris str. ATC... 36 0.032 AE012529 AE008922 Xanthomonas campestris pv. campestris str. ATC... 30 2.0 AE012359 AE008922 Xanthomonas campestris pv. campestris str. ATC... 30 2.0 AE012356 AE008922 Xanthomonas campestris pv. campestris str. ATC... 30 2.0 AE012237 AE008922 Xanthomonas campestris pv. campestris str. ATC... 30 2.0 AE012205 AE008922 Xanthomonas campestris pv. campestris str. ATC... 30 2.0 AE012483 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012452 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012393 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012385 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012374 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012342 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012308 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012303 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012289 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012280 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012260 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012255 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012244 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012229 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012184 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012165 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012162 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012135 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012113 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012106 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 AE012094 AE008922 Xanthomonas campestris pv. campestris str. ATC... 28 7.8 >AE012145 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 53 of 460 of the complete genome. Length = 14145 Score = 36.2 bits (18), Expect = 0.032 Identities = 18/18 (100%) Strand = Plus / Plus Query: 351 cctgaaagaactggctga 368 |||||||||||||||||| Sbjct: 8397 cctgaaagaactggctga 8414 >AE012529 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 437 of 460 of the complete genome. Length = 10679 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 199 gatggcttccgcacc 213 ||||||||||||||| Sbjct: 2097 gatggcttccgcacc 2111 >AE012359 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 267 of 460 of the complete genome. Length = 13043 Score = 30.2 bits (15), Expect = 2.0 Identities = 21/23 (91%) Strand = Plus / Plus Query: 302 aaaccccgctgaaaagttacccg 324 |||| |||||| ||||||||||| Sbjct: 11295 aaacaccgctggaaagttacccg 11317 >AE012356 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 264 of 460 of the complete genome. Length = 10623 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 323 cgctggacatccaca 337 ||||||||||||||| Sbjct: 8494 cgctggacatccaca 8508 >AE012237 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 145 of 460 of the complete genome. Length = 13060 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 210 caccgcactgatcga 224 ||||||||||||||| Sbjct: 9609 caccgcactgatcga 9623 >AE012205 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 113 of 460 of the complete genome. Length = 11594 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 469 aaattcctgtggttt 483 ||||||||||||||| Sbjct: 6592 aaattcctgtggttt 6578 >AE012483 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 391 of 460 of the complete genome. Length = 12502 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 57 cgatgtctccgaca 70 |||||||||||||| Sbjct: 4129 cgatgtctccgaca 4116 >AE012452 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 360 of 460 of the complete genome. Length = 11099 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 330 catccacaacgttc 343 |||||||||||||| Sbjct: 8582 catccacaacgttc 8595 >AE012393 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 301 of 460 of the complete genome. Length = 11733 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 194 tgctggatggcttc 207 |||||||||||||| Sbjct: 6341 tgctggatggcttc 6328 >AE012385 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 293 of 460 of the complete genome. Length = 12485 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 219 gatcgatcatctgg 232 |||||||||||||| Sbjct: 3108 gatcgatcatctgg 3121 >AE012374 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 282 of 460 of the complete genome. Length = 10029 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 79 aaagcaacagtaga 92 |||||||||||||| Sbjct: 9032 aaagcaacagtaga 9045 >AE012342 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 250 of 460 of the complete genome. Length = 11364 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 322 ccgctggacatcca 335 |||||||||||||| Sbjct: 10832 ccgctggacatcca 10819 >AE012308 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 216 of 460 of the complete genome. Length = 11019 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 147 agcgcactggaaca 160 |||||||||||||| Sbjct: 7429 agcgcactggaaca 7416 >AE012303 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 211 of 460 of the complete genome. Length = 12174 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 31 gcgaccaatctgct 44 |||||||||||||| Sbjct: 11988 gcgaccaatctgct 12001 >AE012289 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 197 of 460 of the complete genome. Length = 10029 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 421 gatgacgacaccgc 434 |||||||||||||| Sbjct: 4014 gatgacgacaccgc 4001 >AE012280 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 188 of 460 of the complete genome. Length = 10801 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 155 ggaacatgcgcggc 168 |||||||||||||| Sbjct: 9247 ggaacatgcgcggc 9260 >AE012260 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 168 of 460 of the complete genome. Length = 10596 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 202 ggcttccgcaccgc 215 |||||||||||||| Sbjct: 3579 ggcttccgcaccgc 3566 >AE012255 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 163 of 460 of the complete genome. Length = 12201 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 96 gctgaatcgccagg 109 |||||||||||||| Sbjct: 11503 gctgaatcgccagg 11490 >AE012244 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 152 of 460 of the complete genome. Length = 10029 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 195 gctggatggcttcc 208 |||||||||||||| Sbjct: 3503 gctggatggcttcc 3490 >AE012229 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 137 of 460 of the complete genome. Length = 10029 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 254 tgcagctgggcggt 267 |||||||||||||| Sbjct: 5095 tgcagctgggcggt 5108 >AE012184 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 92 of 460 of the complete genome. Length = 10695 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 387 taatgacgtacgca 400 |||||||||||||| Sbjct: 1904 taatgacgtacgca 1917 >AE012165 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 73 of 460 of the complete genome. Length = 11416 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 253 gtgcagctgggcgg 266 |||||||||||||| Sbjct: 8473 gtgcagctgggcgg 8486 >AE012162 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 70 of 460 of the complete genome. Length = 11262 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 320 acccgctggacatc 333 |||||||||||||| Sbjct: 9164 acccgctggacatc 9151 >AE012135 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 43 of 460 of the complete genome. Length = 10978 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Minus Query: 359 aactggctgaccgt 372 |||||||||||||| Sbjct: 5622 aactggctgaccgt 5609 >AE012113 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 21 of 460 of the complete genome. Length = 11218 Score = 28.2 bits (14), Expect = 7.8 Identities = 17/18 (94%) Strand = Plus / Plus Query: 182 ccgtacatgaaatgctgg 199 |||| ||||||||||||| Sbjct: 5881 ccgtgcatgaaatgctgg 5898 >AE012106 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 14 of 460 of the complete genome. Length = 13051 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 210 caccgcactgatcg 223 |||||||||||||| Sbjct: 2744 caccgcactgatcg 2757 >AE012094 AE008922 Xanthomonas campestris pv. campestris str. ATCC 33913, section 2 of 460 of the complete genome. Length = 10542 Score = 28.2 bits (14), Expect = 7.8 Identities = 14/14 (100%) Strand = Plus / Plus Query: 440 tcctgaccgccgcg 453 |||||||||||||| Sbjct: 4365 tcctgaccgccgcg 4378 Database: xc Posted date: Nov 2, 2009 10:10 PM Number of letters in database: 5,103,728 Number of sequences in database: 460 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 460 Number of Hits to DB: 30,042 Number of extensions: 27 Number of successful extensions: 27 Number of sequences better than 10.0: 27 Number of HSP's gapped: 27 Number of HSP's successfully gapped: 27 Length of query: 504 Length of database: 5,103,728 Length adjustment: 16 Effective length of query: 488 Effective length of database: 5,096,368 Effective search space: 2487027584 Effective search space used: 2487027584 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 50 (99.1 bits) S1: 14 (28.2 bits) S2: 14 (28.2 bits)