Query= aspV
         (77 letters)

Database: xc 
           460 sequences; 5,103,728 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AE012195 AE008922 Xanthomonas campestris pv. campestris str. ATC...    90   3e-19

>AE012195 AE008922 Xanthomonas campestris pv. campestris str. ATCC
            33913,  section 103 of 460 of the complete genome.
          Length = 10083

 Score = 89.7 bits (45), Expect = 3e-19
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1    ggagcggtagttcagtcggttagaatacctgcctgtcacgcagggggtcgcgggttcgag 60
            |||||||||||||||  ||||||||| |  ||||||||||| || |||||||||||||||
Sbjct: 9722 ggagcggtagttcagctggttagaatgctggcctgtcacgccggaggtcgcgggttcgag 9781

                             
Query: 61   tcccgtccgttccgcca 77
            ||||||||| |||||||
Sbjct: 9782 tcccgtccgctccgcca 9798