============================================================= /tmp/gibbs9242/Gibbs9242 /tmp/gibbs9242/data.txt 16 20 -n -r -W 0.8 -w 0.1 -p 200 -j 5 -i 2000 -S 40 -C 0.5 -P /tmp/gibbs9242/prior.txt -R 1,1,8 -U /tmp/gibbs9242/spacing.txt -M 1,24 -B /tmp/gibbs9242/data.txt_info-det -y -nopt -o /tmp/gibbs9242/outfile.txt Gibbs 3.10.001 Sep 8 2009 Data file: /tmp/gibbs9242/data.txt Output file: /tmp/gibbs9242/outfile.txt Priors file: /tmp/gibbs9242/prior.txt Background Composition Model file: /tmp/gibbs9242/data.txt_info-det Spacing Model file: /tmp/gibbs9242/spacing.txt Current directory: /tmp/gibbs9242 The following options are set: Concentrated Region False Sequence type False Collapsed Alphabet False Pseudocount weight True Use Expectation/Maximization False Don't Xnu sequence False Help flag False Near optimal cutoff True Number of iterations True Don't fragment False Don't use map maximization False Repeat regions False Output file True Informed priors file True Plateau periods True palindromic sequence True Don't Reverse complement True Number of seeds True Seed Value False Pseudosite weight True Suboptimal sampler output False Overlap False Allow width to vary False Wilcoxon signed rank False Sample along length False Output Scan File False Output prior file False Modular Sampler False Ignore Spacing Model False Sample Background False Bkgnd Comp Model True Init from prior False Homologous Seq pairs False Parallel Tempering False Group Sampler False No progress info False Fragment from middle False Verify Mode False Alternate sample on k False No freq. soln. True Calc. def. pseudo wt. False Motif/Recur smpl False Phylogenetic Sampling False Supress Near Opt. True Nearopt display cutoff False Sample model False Hierarchical Model False Centroid model False Print Bayesian Counts False Align Centroid False Calculate Credibility Limits False Frequency Bkgnd. False site_samp = 0 nMotifLen = 16 nAlphaLen = 4 nNumMotifs = 20 dPseudoCntWt = 0.1 dPseudoSiteWt = 0.8 nMaxIterations = 2000 lSeedVal = 1338379094 nPlateauPeriods = 200 nSeeds = 40 nNumMotifTypes = 1 dCutoff = 0.5 dNearOptDispCutoff = 0.5 RevComplement = 0 glOverlapParam = 0 Rcutoff factor = 0 Post Plateau Samples = 0 Frag/Shft Per. = 5 Frag width = 24 Sequences to be Searched: _________________________ #1 pheA #2 aroH2 #3 tyrB #4 aroKB1 #5 aroF+tyrA #6 aroA #7 aroL #8 aroC #9 aroG #10 aroD+ydiB Processed Sequence Length: 2000 Total sequence length: 2000 ====================================================================== ======================== MAP MAXIMIZATION RESULTS ==================== ====================================================================== ------------------------------------------------------------------------- MOTIF a Motif model (residue frequency x 100) ____________________________________________ Pos. # a t c g Info _____________________________ 1 | 55 33 . 11 0.3 3 | 11 88 . . 0.8 4 | . 11 11 77 0.8 5 | . 66 . 33 0.6 6 | 100 . . . 1.1 7 | 77 22 . . 0.6 8 | 44 55 . . 0.4 11 | 33 55 11 . 0.3 12 | 55 22 11 11 0.2 15 | . 100 . . 1.0 16 | 11 77 . 11 0.5 17 | 11 88 . . 0.8 18 | 66 . 33 . 0.6 19 | . . 100 . 1.4 20 | 44 44 . 11 0.2 22 | 44 44 11 . 0.2 nonsite 28 30 20 20 site 34 44 11 9 Motif probability model ____________________________________________ Pos. # a t c g ____________________________________________ 1 | 0.506 0.327 0.038 0.129 3 | 0.143 0.782 0.038 0.038 4 | 0.052 0.146 0.128 0.674 5 | 0.052 0.600 0.038 0.311 6 | 0.870 0.055 0.038 0.038 7 | 0.688 0.236 0.038 0.038 8 | 0.415 0.509 0.038 0.038 11 | 0.325 0.509 0.128 0.038 12 | 0.506 0.236 0.128 0.129 15 | 0.052 0.873 0.038 0.038 16 | 0.143 0.691 0.038 0.129 17 | 0.143 0.782 0.038 0.038 18 | 0.597 0.055 0.310 0.038 19 | 0.052 0.055 0.856 0.038 20 | 0.415 0.418 0.038 0.129 22 | 0.415 0.418 0.128 0.038 Background probability model 0.280 0.289 0.214 0.217 16 columns Num Motifs: 9 5, 1 34 aaggg AGTGTAAATTTATCTATACAGA ggtaa 55 0.91 F aroF+tyrA 5, 2 86 ttgcc TGTGTAAATAAAAATGTACGAA atatg 107 0.69 F aroF+tyrA 5, 3 109 cgaaa TATGGATTGAAAACTTTACTTT atgtg 130 0.74 F aroF+tyrA 6, 1 127 tagcc ACAGGAATAATGTATTACCTGT ggtcg 148 0.33 F aroA 7, 1 18 ggcta AATGTAATTTATTATTTACACT tcatt 39 0.88 F aroL 7, 2 94 cttta AGTGGAATTTTTTCTTTACAAT cgaaa 115 0.88 F aroL 8, 1 42 atctg TCTCTATTTCTAATTTTCCTAC agttt 63 0.00 F aroC 8, 2 93 cgatc GTTTTAAACGTATTTTTCCTCA ctcac 114 0.60 F aroC 9, 1 111 ttcat AGTGTAAAACCCCGTTTACACA ttctg 132 0.90 F aroG * ****** ** ****** * Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Forward Motif (F) or Reverse Complement (R) Column 9 : Sequence Description from Fast A input Log Motif portion of MAP for motif a = -132.87875 Log Fragmentation portion of MAP for motif a = -4.78749 Log Background portion of Map = -2561.69422 Log Alignment portion of Map = -60.17486 Log Site/seq portion of Map = 0.00000 Log Null Map = -2756.73189 Non Palindromic Map = -14.49424 Log Map = -2.80343 log MAP = sum of motif and fragmentation parts of MAP + background + alignment + sites/seq - Null Frequency Map = -3.675989 Nearopt Map = -3.214298 Maximal Map = -2.803425 Elapsed time: 15.080000 secs