Поиск гомологов FABI_ECOLI | Геном Vibrio cholerae | Геном Pseudomonas aeruginosa | Геном Pasteurella multocida | |
Характеристика лучшей находки: | ||||
E-value находки | 2e-08 | e-100 | e-118 | |
координаты выравнивания(-ий) в записи генома |
10680-9967 | 874-89 | 7739-6963 | |
AC соответствующей записи EMBL | AE004276 | AE006052 | AE004607 | |
Координаты CDS в записи EMBL (если они есть) | 9952-10698 | |||
AC UniProt в записи EMBL (если есть) | Q9KQH7 | |||
Число находок с Е-value<0,01 |
4 | 24 | 2 | |
E-value лучшей находки в трех геномах |
5e-08 | 1e-99 | e-118 | |
Число находок с Е-value<0,01 в трех геномах |
4 | 24 | 2 |
Score E Sequences producing significant alignments: (bits) Value embl|AE006052|AE006052 Pasteurella multocida subsp. multocida st... 62 2e-09 embl|AE004607|AE004607 Pseudomonas aeruginosa PAO1, section 168 ... 62 2e-09 embl|AE004895|AE004895 Pseudomonas aeruginosa PAO1, section 456 ... 34 0.50 embl|AE006196|AE006196 Pasteurella multocida subsp. multocida st... 32 2.0 embl|AE004765|AE004765 Pseudomonas aeruginosa PAO1, section 326 ... 32 2.0 embl|AE004691|AE004691 Pseudomonas aeruginosa PAO1, section 252 ... 32 2.0 embl|AE004486|AE004486 Pseudomonas aeruginosa PAO1, section 47 o... 32 2.0 embl|AE004280|AE004280 Vibrio cholerae O1 biovar eltor str. N169... 32 2.0 embl|AE004110|AE004110 Vibrio cholerae O1 biovar eltor str. N169... 32 2.0 embl|AE006070|AE006070 Pasteurella multocida subsp. multocida st... 30 7.7 embl|AE006064|AE006064 Pasteurella multocida subsp. multocida st... 30 7.7 embl|AE006060|AE006060 Pasteurella multocida subsp. multocida st... 30 7.7 embl|AE006044|AE006044 Pasteurella multocida subsp. multocida st... 30 7.7 embl|AE004941|AE004941 Pseudomonas aeruginosa PAO1, section 502 ... 30 7.7 embl|AE004880|AE004880 Pseudomonas aeruginosa PAO1, section 441 ... 30 7.7 embl|AE004848|AE004848 Pseudomonas aeruginosa PAO1, section 409 ... 30 7.7 embl|AE004843|AE004843 Pseudomonas aeruginosa PAO1, section 404 ... 30 7.7 embl|AE004780|AE004780 Pseudomonas aeruginosa PAO1, section 341 ... 30 7.7 embl|AE004752|AE004752 Pseudomonas aeruginosa PAO1, section 313 ... 30 7.7 embl|AE004743|AE004743 Pseudomonas aeruginosa PAO1, section 304 ... 30 7.7 embl|AE004472|AE004472 Pseudomonas aeruginosa PAO1, section 33 o... 30 7.7 embl|AE004411|AE004411 Vibrio cholerae O1 biovar eltor str. N169... 30 7.7 embl|AE004345|AE004345 Vibrio cholerae O1 biovar eltor str. N169... 30 7.7 embl|AE004337|AE004337 Vibrio cholerae O1 biovar eltor str. N169... 30 7.7 embl|AE004292|AE004292 Vibrio cholerae O1 biovar eltor str. N169... 30 7.7 embl|AE004199|AE004199 Vibrio cholerae O1 biovar eltor str. N169... 30 7.7 embl|AE004184|AE004184 Vibrio cholerae O1 biovar eltor str. N169... 30 7.7 >embl|AE006052|AE006052 Pasteurella multocida subsp. multocida str. Pm70 section 19 of 204 of the complete genome. Length = 10665 Score = 61.9 bits (31), Expect = 2e-09 Identities = 88/107 (82%) Strand = Plus / Minus Query: 649 cgccgtaccgttactattgaagatgtgggtaactctgcggcattcctgtgctccgatctc 708 |||||||| || || ||||||||||| ||||||||||| || ||| | ||||| ||| | Sbjct: 7094 cgccgtactgtgacgattgaagatgtcggtaactctgcagctttcttatgctcagattta 7035 Query: 709 tctgccggtatctccggtgaagtggtccacgttgacggcggtttcag 755 ||| |||||| | |||||||||||||| ||||| | ||||||||| Sbjct: 7034 agtgctggtatcacaggtgaagtggtccatgttgatgccggtttcag 6988 Score = 32.2 bits (16), Expect = 2.0 Identities = 73/92 (79%) Strand = Plus / Minus Query: 64 tacggtatcgctcaggcgatgcaccgcgaaggagctgaactggcattcacctaccagaac 123 ||||||||||| || || ||| | || ||||| || ||||| || ||||| || || || Sbjct: 7679 tacggtatcgcacaagcaatgaaacgtgaaggggcagaactcgctttcacgtatcaaaat 7620 Query: 124 gacaaactgaaaggccgcgtagaagaatttgc 155 || ||| | ||||| || |||||||||||||| Sbjct: 7619 gataaattaaaagggcgtgtagaagaatttgc 7588 Score = 30.2 bits (15), Expect = 7.7 Identities = 21/23 (91%) Strand = Plus / Minus Query: 367 agcttcgttgcaatggcaaaagc 389 ||||| ||||| ||||||||||| Sbjct: 7376 agctttgttgcgatggcaaaagc 7354 >embl|AE004607|AE004607 Pseudomonas aeruginosa PAO1, section 168 of 529 of the complete genome. Length = 10160 Score = 61.9 bits (31), Expect = 2e-09 Identities = 43/47 (91%) Strand = Plus / Minus Query: 82 atgcaccgcgaaggagctgaactggcattcacctaccagaacgacaa 128 |||||||| ||||| || |||||||| |||||||||||||||||||| Sbjct: 796 atgcaccgggaaggcgccgaactggccttcacctaccagaacgacaa 750 Score = 48.1 bits (24), Expect = 3e-05 Identities = 51/60 (85%) Strand = Plus / Minus Query: 420 cctgctgaccctttcctaccttggcgctgagcgcgctatcccgaactacaacgttatggg 479 |||||||||||| |||||||| ||||| || || | || |||||||||||||| ||||| Sbjct: 449 cctgctgaccctctcctacctgggcgccgaacggaccatgccgaactacaacgtaatggg 390 Score = 46.1 bits (23), Expect = 1e-04 Identities = 26/27 (96%) Strand = Plus / Minus Query: 346 gcccacgacatcagctcctacagcttc 372 ||||||||||||||| ||||||||||| Sbjct: 526 gcccacgacatcagcgcctacagcttc 500 Score = 34.2 bits (17), Expect = 0.50 Identities = 17/17 (100%) Strand = Plus / Minus Query: 607 ttccgcaaaatgctggc 623 ||||||||||||||||| Sbjct: 262 ttccgcaaaatgctggc 246
©Сорочкина Александра