BLASTN 2.2.25+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: lm_genome.fasta 12 sequences; 2,945,078 total letters Query= D64116.1 D64116 Bacillus subtilis genes for ORF1, ORF2, ORF3, ORF4 and Srb, partial and complete cds. Length=234 Score E Sequences producing significant alignments: (Bits) Value embl|AL591981|AL591981 Listeria monocytogenes strain EGD, compl... 154 2e-38 > embl|AL591981|AL591981 Listeria monocytogenes strain EGD, complete genome, segment 9/12 Length=347050 Score = 154 bits (170), Expect = 2e-38 Identities = 168/221 (77%), Gaps = 4/221 (1%) Strand=Plus/Minus Query 1 ATGGCAGACACATTAGAGCGTGTAACGAAAATCATCGTAGATCGCCTTGGCGTTGATGAA 60 |||||||| |||||| || || |||||||||||||| || || || || || ||| Sbjct 128274 ATGGCAGAAGTATTAGAAAAAGTTACAAAAATCATCGTAGACCGTCTAGGTGTCGAGGAA 128215 Query 61 GCAGACGTCAAACTT--GAAGCTTCTTTCAAGGAAGACTTAGGTGCTGATTCCCTAGATG 118 | | || ||||| |||||||| ||||| ||||| ||||||| ||||||||||||| Sbjct 128214 TCCAAAGT--AACTTTAGAAGCTTCCTTCAAAGAAGATCTAGGTGCAGATTCCCTAGATG 128157 Query 119 TAGTTGAGCTTGTTATGGAACTTGAAGACGAGTTTGATATGGAGATTTCTGACGAAGATG 178 | ||||| | || |||||||||||||||||||| | | || || ||||| | || | Sbjct 128156 TTGTTGAATTAGTAATGGAACTTGAAGACGAGTTCGGAGTTGAAATCTCTGATGGCGACG 128097 Query 179 CTGAAAAGATTGCAACAGTCGGCGACGCTGTGAACTACATA 219 ||||||| ||| ||||| || || || ||||| |||||| Sbjct 128096 CTGAAAACATTAACACAGTTGGTGATGCAGTGAAGTACATA 128056 Lambda K H 0.634 0.408 0.912 Gapped Lambda K H 0.625 0.410 0.780 Effective search space used: 624300568 Database: lm_genome.fasta Posted date: Oct 24, 2012 10:18 PM Number of letters in database: 2,945,078 Number of sequences in database: 12 Matrix: blastn matrix 2 -3 Gap Penalties: Existence: 5, Extension: 2