BLASTN 2.2.21 [Jun-14-2009] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= U00096 U00096.2 Escherichia coli str. K-12 substr. MG1655, complete genome. (750 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006126 Pasteurella multocida subsp. multocida str. Pm70 sectio... 34 0.085 AE006084 Pasteurella multocida subsp. multocida str. Pm70 sectio... 32 0.34 AE006155 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3 AE006147 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3 AE006118 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3 AE006081 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3 AE006068 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3 AE006230 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006218 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006207 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006198 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006189 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006164 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006154 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006150 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006132 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006109 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006099 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006089 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006054 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 AE006048 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2 >AE006126 Pasteurella multocida subsp. multocida str. Pm70 section 93 of 204 of the complete genome. Length = 12635 Score = 34.2 bits (17), Expect = 0.085 Identities = 20/21 (95%) Strand = Plus / Minus Query: 620 aagcgatcaaaatgctggcag 640 |||||||||||| |||||||| Sbjct: 9210 aagcgatcaaaaagctggcag 9190 >AE006084 Pasteurella multocida subsp. multocida str. Pm70 section 51 of 204 of the complete genome. Length = 10499 Score = 32.2 bits (16), Expect = 0.34 Identities = 16/16 (100%) Strand = Plus / Plus Query: 77 aggaggcgctgaaaga 92 |||||||||||||||| Sbjct: 3479 aggaggcgctgaaaga 3494 >AE006155 Pasteurella multocida subsp. multocida str. Pm70 section 122 of 204 of the complete genome. Length = 10827 Score = 30.2 bits (15), Expect = 1.3 Identities = 15/15 (100%) Strand = Plus / Plus Query: 78 ggaggcgctgaaaga 92 ||||||||||||||| Sbjct: 145 ggaggcgctgaaaga 159 >AE006147 Pasteurella multocida subsp. multocida str. Pm70 section 114 of 204 of the complete genome. Length = 14766 Score = 30.2 bits (15), Expect = 1.3 Identities = 15/15 (100%) Strand = Plus / Plus Query: 593 gcgtaattggttcgt 607 ||||||||||||||| Sbjct: 1523 gcgtaattggttcgt 1537 >AE006118 Pasteurella multocida subsp. multocida str. Pm70 section 85 of 204 of the complete genome. Length = 11828 Score = 30.2 bits (15), Expect = 1.3 Identities = 18/19 (94%) Strand = Plus / Minus Query: 537 gtttggtgaaaatgcatta 555 ||||| ||||||||||||| Sbjct: 5524 gtttgctgaaaatgcatta 5506 >AE006081 Pasteurella multocida subsp. multocida str. Pm70 section 48 of 204 of the complete genome. Length = 11341 Score = 30.2 bits (15), Expect = 1.3 Identities = 15/15 (100%) Strand = Plus / Plus Query: 534 tttgtttggtgaaaa 548 ||||||||||||||| Sbjct: 3577 tttgtttggtgaaaa 3591 >AE006068 Pasteurella multocida subsp. multocida str. Pm70 section 35 of 204 of the complete genome. Length = 11223 Score = 30.2 bits (15), Expect = 1.3 Identities = 15/15 (100%) Strand = Plus / Minus Query: 562 gtggaagcaggcgta 576 ||||||||||||||| Sbjct: 9023 gtggaagcaggcgta 9009 >AE006230 Pasteurella multocida subsp. multocida str. Pm70 section 197 of 204 of the complete genome. Length = 10325 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 61 tttgattttgacgg 74 |||||||||||||| Sbjct: 9817 tttgattttgacgg 9804 >AE006218 Pasteurella multocida subsp. multocida str. Pm70 section 185 of 204 of the complete genome. Length = 10302 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 61 tttgattttgacgg 74 |||||||||||||| Sbjct: 2367 tttgattttgacgg 2354 >AE006207 Pasteurella multocida subsp. multocida str. Pm70 section 174 of 204 of the complete genome. Length = 10499 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Plus Query: 300 tatcgcgattacgc 313 |||||||||||||| Sbjct: 9293 tatcgcgattacgc 9306 >AE006198 Pasteurella multocida subsp. multocida str. Pm70 section 165 of 204 of the complete genome. Length = 12956 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Plus Query: 302 tcgcgattacgcca 315 |||||||||||||| Sbjct: 8652 tcgcgattacgcca 8665 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Plus Query: 543 tgaaaatgcattaa 556 |||||||||||||| Sbjct: 9428 tgaaaatgcattaa 9441 >AE006189 Pasteurella multocida subsp. multocida str. Pm70 section 156 of 204 of the complete genome. Length = 10307 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 587 tgatcggcgtaatt 600 |||||||||||||| Sbjct: 7295 tgatcggcgtaatt 7282 >AE006164 Pasteurella multocida subsp. multocida str. Pm70 section 131 of 204 of the complete genome. Length = 13857 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 663 gaaaatcgtcatgt 676 |||||||||||||| Sbjct: 12043 gaaaatcgtcatgt 12030 >AE006154 Pasteurella multocida subsp. multocida str. Pm70 section 121 of 204 of the complete genome. Length = 11090 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 586 ttgatcggcgtaat 599 |||||||||||||| Sbjct: 4344 ttgatcggcgtaat 4331 >AE006150 Pasteurella multocida subsp. multocida str. Pm70 section 117 of 204 of the complete genome. Length = 10723 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 311 cgccagtcaatgca 324 |||||||||||||| Sbjct: 6192 cgccagtcaatgca 6179 >AE006132 Pasteurella multocida subsp. multocida str. Pm70 section 99 of 204 of the complete genome. Length = 11793 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 60 ctttgattttgacg 73 |||||||||||||| Sbjct: 10035 ctttgattttgacg 10022 >AE006109 Pasteurella multocida subsp. multocida str. Pm70 section 76 of 204 of the complete genome. Length = 13603 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 538 tttggtgaaaatgc 551 |||||||||||||| Sbjct: 9507 tttggtgaaaatgc 9494 >AE006099 Pasteurella multocida subsp. multocida str. Pm70 section 66 of 204 of the complete genome. Length = 11156 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 533 gtttgtttggtgaa 546 |||||||||||||| Sbjct: 2770 gtttgtttggtgaa 2757 >AE006089 Pasteurella multocida subsp. multocida str. Pm70 section 56 of 204 of the complete genome. Length = 12519 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Plus Query: 351 attgattgctgaac 364 |||||||||||||| Sbjct: 10197 attgattgctgaac 10210 >AE006054 Pasteurella multocida subsp. multocida str. Pm70 section 21 of 204 of the complete genome. Length = 11152 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Plus Query: 474 aggtcaaatcaccg 487 |||||||||||||| Sbjct: 7931 aggtcaaatcaccg 7944 >AE006048 Pasteurella multocida subsp. multocida str. Pm70 section 15 of 204 of the complete genome. Length = 12232 Score = 28.2 bits (14), Expect = 5.2 Identities = 14/14 (100%) Strand = Plus / Minus Query: 712 ctgatgcgtaatcc 725 |||||||||||||| Sbjct: 3688 ctgatgcgtaatcc 3675 Database: pm Posted date: Nov 5, 2009 1:39 AM Number of letters in database: 2,269,587 Number of sequences in database: 204 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 204 Number of Hits to DB: 13,771 Number of extensions: 22 Number of successful extensions: 22 Number of sequences better than 10.0: 21 Number of HSP's gapped: 22 Number of HSP's successfully gapped: 22 Length of query: 750 Length of database: 2,269,587 Length adjustment: 15 Effective length of query: 735 Effective length of database: 2,266,527 Effective search space: 1665897345 Effective search space used: 1665897345 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 50 (99.1 bits) S1: 14 (28.2 bits) S2: 14 (28.2 bits)