Database and Motifs | High-scoring Motif Occurences | Debugging Information | Results in TSV Format | Results in GFF3 Format |
FIMO version 5.1.1, (Release date: Wed Jan 29 15:00:42 2020 -0800)
For further information on how to interpret these results please access http://meme-suite.org//doc/fimo-output-format.html.
To get a copy of the FIMO software please access http://meme-suite.org
If you use FIMO in your research, please cite the following paper:
Charles E. Grant, Timothy L. Bailey, and William Stafford Noble,
"FIMO: Scanning for occurrences of a given motif",
Bioinformatics, 27(7):1017-1018, 2011.
[full text]
DATABASE bulbul.fasta
Database contains 1 sequences, 26487 residues
MOTIFS motifs.meme (DNA)
MOTIF | WIDTH | BEST POSSIBLE MATCH |
---|---|---|
1 | 20 | CAATACCAGTACTATATCAG |
Random model letter frequencies (--nrdb--):
A 0.282 C 0.222 G 0.229 T 0.267
Motif ID | Alt ID | Sequence Name | Strand | Start | End | p-value | q-value | Matched Sequence |
---|---|---|---|---|---|---|---|---|
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 25704 | 25723 | 5.21e-09 | 0.000126 | CCATACCACTACCACCTCAG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 25944 | 25963 | 7e-08 | 0.000849 | CAATTCCAGACTTAGAGCAG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 22845 | 22864 | 1.27e-07 | 0.00103 | CAACACCAGTATCATTTAAA |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 23058 | 23077 | 5.35e-07 | 0.00267 | AAACCCCACTCCTACAGATG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 23771 | 23790 | 5.5e-07 | 0.00267 | AATTTCTACTTCCAGTTCAG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 543 | 562 | 9.28e-07 | 0.00375 | AAGTACCAAACCCATAGGAG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 19291 | 19310 | 8.79e-06 | 0.0305 | CAACTCCTATAATATCTCTC |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 8903 | 8922 | 1.24e-05 | 0.0351 | AAGCACCTATAACATTGCAA |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 16924 | 16943 | 1.3e-05 | 0.0351 | AATTTCCAGTAACTCCTGAG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 24069 | 24088 | 1.67e-05 | 0.0405 | CTTTACAAGTTATACTTGAA |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 11435 | 11454 | 2.76e-05 | 0.0609 | ACATAACAATACTACCTCTG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 227 | 246 | 3.86e-05 | 0.078 | TAACACCACATTCAGTGGTG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 21388 | 21407 | 7.17e-05 | 0.134 | CATTATCACTTCTAAATCTG |
1 | MAWYWCCAVTHHYABHKVAR | NC_011547.1 | + | 11255 | 11274 | 9.67e-05 | 0.168 | CTTTTGCACTTACACATGAA |
Command line:
fimo --oc . --verbosity 1 --thresh 1.0E-4 --norc motifs.meme bulbul.fasta
Settings:
output_directory = . | MEME file name = motifs.meme | sequence file name = bulbul.fasta |
background file name = --nrdb-- | alphabet = DNA | max stored scores = 100000 |
allow clobber = true | compute q-values = true | parse genomic coord. = false |
text only = false | scan both strands = false | max strand = false |
threshold type = p-value | output theshold = 0.0001 | pseudocount = 0.1 |
alpha = 1 | verbosity = 1 |
This information can be useful in the event you wish to report a problem with the FIMO software.