BLASTN 2.2.15 [Oct-15-2006]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Sequence 768 BP;
(255 letters)
Database: all
884 sequences; 12,243,887 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AE008821 AE006468 |AE008821| Salmonella typhimurium LT2, section... 406 e-113
embl|AE006168|AE006168 Pasteurella multocida subsp. multocida st... 46 4e-05
>AE008821 AE006468 |AE008821| Salmonella typhimurium LT2, section 125 of
220 of the complete genome.
Length = 21387
Score = 406 bits (205), Expect = e-113
Identities = 238/249 (95%)
Strand = Plus / Minus
Query: 7 attggcataattagcctgtttcctgaaatgttccgcgcaattaccgattacggggtaact 66
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14165 attggcatagttagcctgtttcctgaaatgttccgcgcaattaccgattacggggtaact 14106
Query: 67 ggccgggcagttaaaaatggcctgctgagcatccagagctggagtcctcgcgacttcacg 126
||||||||||| ||||| |||||||||| |||||| ||||||||||||||||||||| ||
Sbjct: 14105 ggccgggcagtaaaaaaaggcctgctgaacatccaaagctggagtcctcgcgacttcgcg 14046
Query: 127 catgaccggcaccgtaccgtggacgatcgtccttacggcggcggaccggggatgttaatg 186
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 14045 catgaccggcaccgtaccgtggacgaccgtccttacggcggcggaccggggatgttaatg 13986
Query: 187 atggtgcaacccttgcgggacgccattcatgcagcaaaagccgcggcgggtgaaggcgca 246
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||
Sbjct: 13985 atggtgcaacccttgcgggacgccattcacgcagcaaaagccgcggcaggtgaaggcgct 13926
Query: 247 aaggtgatt 255
|| ||||||
Sbjct: 13925 aaagtgatt 13917
>embl|AE006168|AE006168 Pasteurella multocida subsp. multocida str.
Pm70 section 135 of 204 of the complete genome.
Length = 11367
Score = 46.1 bits (23), Expect = 4e-05
Identities = 68/83 (81%)
Strand = Plus / Plus
Query: 145 gtggacgatcgtccttacggcggcggaccggggatgttaatgatggtgcaacccttgcgg 204
||||| ||||| ||||| ||||| || || || ||| | ||||||||||| || || |||
Sbjct: 7363 gtggatgatcgcccttatggcggtggtccaggtatgctgatgatggtgcagcctttacgg 7422
Query: 205 gacgccattcatgcagcaaaagc 227
|| || ||||| |||||||||||
Sbjct: 7423 gatgcgattcaagcagcaaaagc 7445
Database: all
Posted date: Nov 7, 2008 5:17 PM
Number of letters in database: 12,243,887
Number of sequences in database: 884
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 884
Number of Hits to DB: 38,130
Number of extensions: 1943
Number of successful extensions: 51
Number of sequences better than 1.0e-03: 2
Number of HSP's gapped: 51
Number of HSP's successfully gapped: 2
Length of query: 255
Length of database: 12,243,887
Length adjustment: 16
Effective length of query: 239
Effective length of database: 12,229,743
Effective search space: 2922908577
Effective search space used: 2922908577
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
S2: 21 (42.1 bits)