A-, B-, and Z-forms of DNA were constructed using 3DNA software.
The following programs were used to build the models:
A-DNA: fiber -seq="GATCGATCGATCGATCGATC" -a gatc-a.pdb
fiber -seq="GATCGATCGATCGATCGATC" -b gatc-b.pdb
fiber -z gatc-z.pdb Number of repeats=25
For this exercise, I chose T27 in the B-DNA. Atoms directed toward the small groove are highlighted in blue, and atoms directed toward the large groove are highlighted in red
Atoms that are oriented toward the large groove:[DT]27:B.7, [DT]27:B.O4
Atoms that are oriented toward the small groove:[DT]27:B.N1, [DT]27:B.O2
A-DNA | B-DNA | Z-DNA | |
Helix type | right-handed | right-handed | left-handed |
Helix pitch, Å | 28,03 | 33,75 | 42,81 |
Number of bases per turn | 11 | 10 | 12 |
Width of the large groove, Å | 16,81 [DC]12:A.P - [DT]31:B.P | 17,21 [DG]13:A.P-[DA]30:B.P | 14,73 [DC}12:A.P-[DC]90:B.P |
Width of the small groove, Å | 9,48[DT]7:A.P-[DG]29:B.P | 11,69 [DT]31:B.P-[DA]14:A.P | 7,20 [DG]9:A.P-[DG]95:B.P |
Strand 1 | Strand 2 | |
2-7 | 66-71 | |
49-53 | 61-65 | |
37-44 | 26-33 | |
10-12 | 23-25 |
55U-18G
38U-32U
44C-26A
13A-45A
14A-21A
19G-56C is additional hydrogen bond that maintains the tertiary structure of tRNA