BLASTN 2.2.10 [Oct-19-2004] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= M34234 M34234.1 E.coli L-asparaginase II (ansB) gene, complete cds. (1047 letters) Database: 3g 1077 sequences; 12,619,654 total letters Searching...done Score E Sequences producing significant alignments: (bits) Value embl|AE004563|AE004563 Pseudomonas aeruginosa PAO1, section 124 ... 50 1e-05 embl|AE004799|AE004799 Pseudomonas aeruginosa PAO1, section 360 ... 36 0.17 embl|AE004720|AE004720 Pseudomonas aeruginosa PAO1, section 281 ... 34 0.66 embl|AE004580|AE004580 Pseudomonas aeruginosa PAO1, section 141 ... 34 0.66 embl|AE004480|AE004480 Pseudomonas aeruginosa PAO1, section 41 o... 34 0.66 embl|AE004286|AE004286 Vibrio cholerae O1 biovar eltor str. N169... 34 0.66 embl|AE006198|AE006198 Pasteurella multocida subsp. multocida st... 32 2.6 embl|AE004942|AE004942 Pseudomonas aeruginosa PAO1, section 503 ... 32 2.6 embl|AE004920|AE004920 Pseudomonas aeruginosa PAO1, section 481 ... 32 2.6 embl|AE004853|AE004853 Pseudomonas aeruginosa PAO1, section 414 ... 32 2.6 embl|AE004788|AE004788 Pseudomonas aeruginosa PAO1, section 349 ... 32 2.6 embl|AE004773|AE004773 Pseudomonas aeruginosa PAO1, section 334 ... 32 2.6 embl|AE004734|AE004734 Pseudomonas aeruginosa PAO1, section 295 ... 32 2.6 embl|AE004716|AE004716 Pseudomonas aeruginosa PAO1, section 277 ... 32 2.6 embl|AE004650|AE004650 Pseudomonas aeruginosa PAO1, section 211 ... 32 2.6 embl|AE004629|AE004629 Pseudomonas aeruginosa PAO1, section 190 ... 32 2.6 embl|AE004564|AE004564 Pseudomonas aeruginosa PAO1, section 125 ... 32 2.6 embl|AE004400|AE004400 Vibrio cholerae O1 biovar eltor str. N169... 32 2.6 embl|AE004312|AE004312 Vibrio cholerae O1 biovar eltor str. N169... 32 2.6 embl|AE004284|AE004284 Vibrio cholerae O1 biovar eltor str. N169... 32 2.6 embl|AE004257|AE004257 Vibrio cholerae O1 biovar eltor str. N169... 32 2.6 embl|AE004189|AE004189 Vibrio cholerae O1 biovar eltor str. N169... 32 2.6 >embl|AE004563|AE004563 Pseudomonas aeruginosa PAO1, section 124 of 529 of the complete genome. Length = 9937 Score = 50.1 bits (25), Expect = 1e-05 Identities = 49/57 (85%) Strand = Plus / Minus Query: 306 cgacggcttcgtcattacccacggtaccgacacgatggaagaaactgcttacttcct 362 ||||||| |||| || ||||||||||||||||| ||||||| || || |||||||| Sbjct: 4245 cgacggcatcgtgatcacccacggtaccgacaccctggaagagaccgcctacttcct 4189 >embl|AE004799|AE004799 Pseudomonas aeruginosa PAO1, section 360 of 529 of the complete genome. Length = 14652 Score = 36.2 bits (18), Expect = 0.17 Identities = 18/18 (100%) Strand = Plus / Minus Query: 389 cggtggtgatggtcggcg 406 |||||||||||||||||| Sbjct: 1593 cggtggtgatggtcggcg 1576 >embl|AE004720|AE004720 Pseudomonas aeruginosa PAO1, section 281 of 529 of the complete genome. Length = 12547 Score = 34.2 bits (17), Expect = 0.66 Identities = 17/17 (100%) Strand = Plus / Plus Query: 391 gtggtgatggtcggcgc 407 ||||||||||||||||| Sbjct: 3268 gtggtgatggtcggcgc 3284 >embl|AE004580|AE004580 Pseudomonas aeruginosa PAO1, section 141 of 529 of the complete genome. Length = 15247 Score = 34.2 bits (17), Expect = 0.66 Identities = 17/17 (100%) Strand = Plus / Minus Query: 1012 ccgcagcagatccagca 1028 ||||||||||||||||| Sbjct: 1272 ccgcagcagatccagca 1256 >embl|AE004480|AE004480 Pseudomonas aeruginosa PAO1, section 41 of 529 of the complete genome. Length = 10910 Score = 34.2 bits (17), Expect = 0.66 Identities = 17/17 (100%) Strand = Plus / Plus Query: 104 ttgccggtggtggtgac 120 ||||||||||||||||| Sbjct: 5410 ttgccggtggtggtgac 5426 >embl|AE004286|AE004286 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 194 of 251 of the complete chromosome. Length = 10185 Score = 34.2 bits (17), Expect = 0.66 Identities = 17/17 (100%) Strand = Plus / Plus Query: 57 agcattggcattaccca 73 ||||||||||||||||| Sbjct: 7749 agcattggcattaccca 7765 >embl|AE006198|AE006198 Pasteurella multocida subsp. multocida str. Pm70 section 165 of 204 of the complete genome. Length = 12956 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 552 aaccaacaccaccgac 567 |||||||||||||||| Sbjct: 9803 aaccaacaccaccgac 9818 >embl|AE004942|AE004942 Pseudomonas aeruginosa PAO1, section 503 of 529 of the complete genome. Length = 10977 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 823 gtgttcgacacgctgg 838 |||||||||||||||| Sbjct: 366 gtgttcgacacgctgg 351 >embl|AE004920|AE004920 Pseudomonas aeruginosa PAO1, section 481 of 529 of the complete genome. Length = 12978 Score = 32.2 bits (16), Expect = 2.6 Identities = 19/20 (95%) Strand = Plus / Plus Query: 904 caggatgccgaagtggatga 923 |||||||||||| ||||||| Sbjct: 10557 caggatgccgaactggatga 10576 >embl|AE004853|AE004853 Pseudomonas aeruginosa PAO1, section 414 of 529 of the complete genome. Length = 11064 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 214 ggcgagcaggtagtga 229 |||||||||||||||| Sbjct: 6439 ggcgagcaggtagtga 6454 >embl|AE004788|AE004788 Pseudomonas aeruginosa PAO1, section 349 of 529 of the complete genome. Length = 10652 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 979 ctgctgcaactggctc 994 |||||||||||||||| Sbjct: 7432 ctgctgcaactggctc 7447 >embl|AE004773|AE004773 Pseudomonas aeruginosa PAO1, section 334 of 529 of the complete genome. Length = 10822 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 22 gcacttgccgcactgg 37 |||||||||||||||| Sbjct: 6010 gcacttgccgcactgg 5995 >embl|AE004734|AE004734 Pseudomonas aeruginosa PAO1, section 295 of 529 of the complete genome. Length = 11120 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 391 gtggtgatggtcggcg 406 |||||||||||||||| Sbjct: 7158 gtggtgatggtcggcg 7143 >embl|AE004716|AE004716 Pseudomonas aeruginosa PAO1, section 277 of 529 of the complete genome. Length = 11610 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 392 tggtgatggtcggcgc 407 |||||||||||||||| Sbjct: 10490 tggtgatggtcggcgc 10475 >embl|AE004650|AE004650 Pseudomonas aeruginosa PAO1, section 211 of 529 of the complete genome. Length = 10315 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 489 cgccaaccgtggcgtg 504 |||||||||||||||| Sbjct: 6032 cgccaaccgtggcgtg 6047 >embl|AE004629|AE004629 Pseudomonas aeruginosa PAO1, section 190 of 529 of the complete genome. Length = 10541 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 834 gctggcgaccgccgcg 849 |||||||||||||||| Sbjct: 8783 gctggcgaccgccgcg 8768 >embl|AE004564|AE004564 Pseudomonas aeruginosa PAO1, section 125 of 529 of the complete genome. Length = 10515 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 357 cttcctcgacctgacg 372 |||||||||||||||| Sbjct: 7822 cttcctcgacctgacg 7837 >embl|AE004400|AE004400 Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 57 of 93 of the complete chromosome. Length = 14331 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 182 tgccgcaactaaaaga 197 |||||||||||||||| Sbjct: 4663 tgccgcaactaaaaga 4648 >embl|AE004312|AE004312 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 220 of 251 of the complete chromosome. Length = 12625 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 391 gtggtgatggtcggcg 406 |||||||||||||||| Sbjct: 3771 gtggtgatggtcggcg 3786 >embl|AE004284|AE004284 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 192 of 251 of the complete chromosome. Length = 10039 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 104 ttgccggtggtggtga 119 |||||||||||||||| Sbjct: 6608 ttgccggtggtggtga 6593 >embl|AE004257|AE004257 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 165 of 251 of the complete chromosome. Length = 11816 Score = 32.2 bits (16), Expect = 2.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1006 aaagatccgcagcaga 1021 |||||||||||||||| Sbjct: 6718 aaagatccgcagcaga 6703 >embl|AE004189|AE004189 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 97 of 251 of the complete chromosome. Length = 15543 Score = 32.2 bits (16), Expect = 2.6 Identities = 19/20 (95%) Strand = Plus / Minus Query: 607 tacattcacaacggtaagat 626 ||||||||||| |||||||| Sbjct: 1945 tacattcacaaaggtaagat 1926 Database: 3g Posted date: Oct 2, 2006 11:55 PM Number of letters in database: 12,619,654 Number of sequences in database: 1077 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 8072 Number of Sequences: 1077 Number of extensions: 8072 Number of successful extensions: 57 Number of sequences better than 10.0: 22 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33 Number of HSP's gapped (non-prelim): 24 length of query: 1047 length of database: 12,619,654 effective HSP length: 17 effective length of query: 1030 effective length of database: 12,601,345 effective search space: 12979385350 effective search space used: 12979385350 T: 0 A: 0 X1: 11 (21.8 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 16 (32.2 bits)