BLASTN 2.2.10 [Oct-19-2004]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
         (76 letters)

Database: bs 
           1 sequences; 4,214,630 total letters

Searching.done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosom...    40   2e-04

>AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosome, complete
               sequence.
          Length = 4214630

 Score = 40.1 bits (20), Expect = 2e-04
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                       
Query: 8       tagctcagtcggtagagcaggggattgaaaatccccgtgtccttggttcgattccg 63
               ||||||||| |||||||||  ||| |||||||||  |||||   ||||||||||||
Sbjct: 4153875 tagctcagttggtagagcaacggactgaaaatccgtgtgtcggcggttcgattccg 4153820



 Score = 40.1 bits (20), Expect = 2e-04
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                       
Query: 8       tagctcagtcggtagagcaggggattgaaaatccccgtgtccttggttcgattccg 63
               ||||||||| |||||||||  ||| |||||||||  |||||   ||||||||||||
Sbjct: 3171539 tagctcagttggtagagcaacggactgaaaatccgtgtgtcggcggttcgattccg 3171484



 Score = 28.2 bits (14), Expect = 0.82
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 59      ttccgagtccgggc 72
               ||||||||||||||
Sbjct: 2835185 ttccgagtccgggc 2835198



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                            
Query: 52      ggttcgattccga 64
               |||||||||||||
Sbjct: 3652743 ggttcgattccga 3652755



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                            
Query: 30      gattgaaaatccc 42
               |||||||||||||
Sbjct: 3508638 gattgaaaatccc 3508650



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Minus

                            
Query: 52      ggttcgattccga 64
               |||||||||||||
Sbjct: 2737814 ggttcgattccga 2737802



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Minus

                            
Query: 24      gcaggggattgaa 36
               |||||||||||||
Sbjct: 1937181 gcaggggattgaa 1937169



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Minus

                            
Query: 2       cccggatagctca 14
               |||||||||||||
Sbjct: 1787845 cccggatagctca 1787833



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                            
Query: 46      gtccttggttcga 58
               |||||||||||||
Sbjct: 1510481 gtccttggttcga 1510493



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                            
Query: 56      cgattccgagtcc 68
               |||||||||||||
Sbjct: 1173707 cgattccgagtcc 1173719



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                           
Query: 31     attgaaaatcccc 43
              |||||||||||||
Sbjct: 652126 attgaaaatcccc 652138



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Minus

                           
Query: 31     attgaaaatcccc 43
              |||||||||||||
Sbjct: 599296 attgaaaatcccc 599284



 Score = 26.3 bits (13), Expect = 3.2
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                          
Query: 21    agagcaggggatt 33
             |||||||||||||
Sbjct: 73196 agagcaggggatt 73208


  Database: bs
    Posted date:  Oct 1, 2006  7:52 PM
  Number of letters in database: 4,214,630
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 134
Number of Sequences: 1
Number of extensions: 134
Number of successful extensions: 13
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 13
length of query: 76
length of database: 4,214,630
effective HSP length: 14
effective length of query: 62
effective length of database: 4,214,616
effective search space: 261306192
effective search space used: 261306192
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)