MEGABLAST 2.2.10 [Oct-19-2004]


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), 
"A greedy algorithm for aligning DNA sequences", 
J Comput Biol 2000; 7(1-2):203-14.

Database: bs 
           1 sequences; 4,214,630 total letters

Searching. done
Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
         (76 letters)



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosom...    40   2e-04

>AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosome, complete
               sequence.
          Length = 4214630

 Score = 40.1 bits (20), Expect = 2e-04
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                       
Query: 8       tagctcagtcggtagagcaggggattgaaaatccccgtgtccttggttcgattccg 63
               ||||||||| |||||||||  ||| |||||||||  |||||   ||||||||||||
Sbjct: 4153875 tagctcagttggtagagcaacggactgaaaatccgtgtgtcggcggttcgattccg 4153820



 Score = 40.1 bits (20), Expect = 2e-04
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                       
Query: 8       tagctcagtcggtagagcaggggattgaaaatccccgtgtccttggttcgattccg 63
               ||||||||| |||||||||  ||| |||||||||  |||||   ||||||||||||
Sbjct: 3171539 tagctcagttggtagagcaacggactgaaaatccgtgtgtcggcggttcgattccg 3171484


  Database: bs
    Posted date:  Oct 1, 2006  7:52 PM
  Number of letters in database: 4,214,630
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 0, Extension: 0
Number of Hits to DB: 24
Number of Sequences: 1
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 0
length of query: 76
length of database: 4,214,630
effective HSP length: 15
effective length of query: 61
effective length of database: 4,214,615
effective search space: 257091515
effective search space used:        0
S2: 13 (26.3 bits)