BLASTN 2.2.10 [Oct-19-2004] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= (582 letters) Database: 3g 1077 sequences; 12,619,654 total letters Searching...done Score E Sequences producing significant alignments: (bits) Value embl|AE004680|AE004680 Pseudomonas aeruginosa PAO1, section 241 ... 42 0.001 embl|AE004891|AE004891 Pseudomonas aeruginosa PAO1, section 452 ... 40 0.006 embl|AE004626|AE004626 Pseudomonas aeruginosa PAO1, section 187 ... 36 0.092 embl|AE004920|AE004920 Pseudomonas aeruginosa PAO1, section 481 ... 34 0.36 embl|AE004657|AE004657 Pseudomonas aeruginosa PAO1, section 218 ... 34 0.36 embl|AE004641|AE004641 Pseudomonas aeruginosa PAO1, section 202 ... 34 0.36 embl|AE004557|AE004557 Pseudomonas aeruginosa PAO1, section 118 ... 34 0.36 embl|AE004541|AE004541 Pseudomonas aeruginosa PAO1, section 102 ... 34 0.36 embl|AE004506|AE004506 Pseudomonas aeruginosa PAO1, section 67 o... 34 0.36 embl|AE004444|AE004444 Pseudomonas aeruginosa PAO1, section 5 of... 34 0.36 embl|AE006055|AE006055 Pasteurella multocida subsp. multocida st... 32 1.4 embl|AE004955|AE004955 Pseudomonas aeruginosa PAO1, section 516 ... 32 1.4 embl|AE004934|AE004934 Pseudomonas aeruginosa PAO1, section 495 ... 32 1.4 embl|AE004914|AE004914 Pseudomonas aeruginosa PAO1, section 475 ... 32 1.4 embl|AE004879|AE004879 Pseudomonas aeruginosa PAO1, section 440 ... 32 1.4 embl|AE004873|AE004873 Pseudomonas aeruginosa PAO1, section 434 ... 32 1.4 embl|AE004860|AE004860 Pseudomonas aeruginosa PAO1, section 421 ... 32 1.4 embl|AE004837|AE004837 Pseudomonas aeruginosa PAO1, section 398 ... 32 1.4 embl|AE004823|AE004823 Pseudomonas aeruginosa PAO1, section 384 ... 32 1.4 embl|AE004817|AE004817 Pseudomonas aeruginosa PAO1, section 378 ... 32 1.4 embl|AE004808|AE004808 Pseudomonas aeruginosa PAO1, section 369 ... 32 1.4 embl|AE004767|AE004767 Pseudomonas aeruginosa PAO1, section 328 ... 32 1.4 embl|AE004755|AE004755 Pseudomonas aeruginosa PAO1, section 316 ... 32 1.4 embl|AE004718|AE004718 Pseudomonas aeruginosa PAO1, section 279 ... 32 1.4 embl|AE004667|AE004667 Pseudomonas aeruginosa PAO1, section 228 ... 32 1.4 embl|AE004585|AE004585 Pseudomonas aeruginosa PAO1, section 146 ... 32 1.4 embl|AE004564|AE004564 Pseudomonas aeruginosa PAO1, section 125 ... 32 1.4 embl|AE004486|AE004486 Pseudomonas aeruginosa PAO1, section 47 o... 32 1.4 embl|AE004480|AE004480 Pseudomonas aeruginosa PAO1, section 41 o... 32 1.4 embl|AE004454|AE004454 Pseudomonas aeruginosa PAO1, section 15 o... 32 1.4 embl|AE004450|AE004450 Pseudomonas aeruginosa PAO1, section 11 o... 32 1.4 embl|AE006209|AE006209 Pasteurella multocida subsp. multocida st... 30 5.7 embl|AE006193|AE006193 Pasteurella multocida subsp. multocida st... 30 5.7 embl|AE006186|AE006186 Pasteurella multocida subsp. multocida st... 30 5.7 embl|AE006130|AE006130 Pasteurella multocida subsp. multocida st... 30 5.7 embl|AE006082|AE006082 Pasteurella multocida subsp. multocida st... 30 5.7 embl|AE006065|AE006065 Pasteurella multocida subsp. multocida st... 30 5.7 embl|AE004967|AE004967 Pseudomonas aeruginosa PAO1, section 528 ... 30 5.7 embl|AE004958|AE004958 Pseudomonas aeruginosa PAO1, section 519 ... 30 5.7 embl|AE004943|AE004943 Pseudomonas aeruginosa PAO1, section 504 ... 30 5.7 embl|AE004928|AE004928 Pseudomonas aeruginosa PAO1, section 489 ... 30 5.7 embl|AE004922|AE004922 Pseudomonas aeruginosa PAO1, section 483 ... 30 5.7 embl|AE004911|AE004911 Pseudomonas aeruginosa PAO1, section 472 ... 30 5.7 embl|AE004889|AE004889 Pseudomonas aeruginosa PAO1, section 450 ... 30 5.7 embl|AE004884|AE004884 Pseudomonas aeruginosa PAO1, section 445 ... 30 5.7 embl|AE004870|AE004870 Pseudomonas aeruginosa PAO1, section 431 ... 30 5.7 embl|AE004853|AE004853 Pseudomonas aeruginosa PAO1, section 414 ... 30 5.7 embl|AE004834|AE004834 Pseudomonas aeruginosa PAO1, section 395 ... 30 5.7 embl|AE004798|AE004798 Pseudomonas aeruginosa PAO1, section 359 ... 30 5.7 embl|AE004794|AE004794 Pseudomonas aeruginosa PAO1, section 355 ... 30 5.7 embl|AE004791|AE004791 Pseudomonas aeruginosa PAO1, section 352 ... 30 5.7 embl|AE004776|AE004776 Pseudomonas aeruginosa PAO1, section 337 ... 30 5.7 embl|AE004773|AE004773 Pseudomonas aeruginosa PAO1, section 334 ... 30 5.7 embl|AE004765|AE004765 Pseudomonas aeruginosa PAO1, section 326 ... 30 5.7 embl|AE004719|AE004719 Pseudomonas aeruginosa PAO1, section 280 ... 30 5.7 embl|AE004707|AE004707 Pseudomonas aeruginosa PAO1, section 268 ... 30 5.7 embl|AE004689|AE004689 Pseudomonas aeruginosa PAO1, section 250 ... 30 5.7 embl|AE004679|AE004679 Pseudomonas aeruginosa PAO1, section 240 ... 30 5.7 embl|AE004673|AE004673 Pseudomonas aeruginosa PAO1, section 234 ... 30 5.7 embl|AE004669|AE004669 Pseudomonas aeruginosa PAO1, section 230 ... 30 5.7 embl|AE004648|AE004648 Pseudomonas aeruginosa PAO1, section 209 ... 30 5.7 embl|AE004614|AE004614 Pseudomonas aeruginosa PAO1, section 175 ... 30 5.7 embl|AE004612|AE004612 Pseudomonas aeruginosa PAO1, section 173 ... 30 5.7 embl|AE004567|AE004567 Pseudomonas aeruginosa PAO1, section 128 ... 30 5.7 embl|AE004549|AE004549 Pseudomonas aeruginosa PAO1, section 110 ... 30 5.7 embl|AE004538|AE004538 Pseudomonas aeruginosa PAO1, section 99 o... 30 5.7 embl|AE004530|AE004530 Pseudomonas aeruginosa PAO1, section 91 o... 30 5.7 embl|AE004492|AE004492 Pseudomonas aeruginosa PAO1, section 53 o... 30 5.7 embl|AE004473|AE004473 Pseudomonas aeruginosa PAO1, section 34 o... 30 5.7 embl|AE004466|AE004466 Pseudomonas aeruginosa PAO1, section 27 o... 30 5.7 embl|AE004443|AE004443 Pseudomonas aeruginosa PAO1, section 4 of... 30 5.7 embl|AE004382|AE004382 Vibrio cholerae O1 biovar eltor str. N169... 30 5.7 embl|AE004353|AE004353 Vibrio cholerae O1 biovar eltor str. N169... 30 5.7 embl|AE004302|AE004302 Vibrio cholerae O1 biovar eltor str. N169... 30 5.7 embl|AE004240|AE004240 Vibrio cholerae O1 biovar eltor str. N169... 30 5.7 embl|AE004198|AE004198 Vibrio cholerae O1 biovar eltor str. N169... 30 5.7 >embl|AE004680|AE004680 Pseudomonas aeruginosa PAO1, section 241 of 529 of the complete genome. Length = 12370 Score = 42.1 bits (21), Expect = 0.001 Identities = 24/25 (96%) Strand = Plus / Minus Query: 259 gagctggcgctggcggtgacgctgg 283 |||||||||||||||||| |||||| Sbjct: 6942 gagctggcgctggcggtggcgctgg 6918 >embl|AE004891|AE004891 Pseudomonas aeruginosa PAO1, section 452 of 529 of the complete genome. Length = 10361 Score = 40.1 bits (20), Expect = 0.006 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 gccgctggcgctgcgtccgg 454 |||||||||||||||||||| Sbjct: 4970 gccgctggcgctgcgtccgg 4951 >embl|AE004626|AE004626 Pseudomonas aeruginosa PAO1, section 187 of 529 of the complete genome. Length = 11354 Score = 36.2 bits (18), Expect = 0.092 Identities = 18/18 (100%) Strand = Plus / Minus Query: 432 gctgccgctggcgctgcg 449 |||||||||||||||||| Sbjct: 4116 gctgccgctggcgctgcg 4099 >embl|AE004920|AE004920 Pseudomonas aeruginosa PAO1, section 481 of 529 of the complete genome. Length = 12978 Score = 34.2 bits (17), Expect = 0.36 Identities = 17/17 (100%) Strand = Plus / Plus Query: 187 gccgcgcttgaccgcgt 203 ||||||||||||||||| Sbjct: 8226 gccgcgcttgaccgcgt 8242 >embl|AE004657|AE004657 Pseudomonas aeruginosa PAO1, section 218 of 529 of the complete genome. Length = 11869 Score = 34.2 bits (17), Expect = 0.36 Identities = 17/17 (100%) Strand = Plus / Minus Query: 432 gctgccgctggcgctgc 448 ||||||||||||||||| Sbjct: 1259 gctgccgctggcgctgc 1243 >embl|AE004641|AE004641 Pseudomonas aeruginosa PAO1, section 202 of 529 of the complete genome. Length = 12075 Score = 34.2 bits (17), Expect = 0.36 Identities = 17/17 (100%) Strand = Plus / Plus Query: 432 gctgccgctggcgctgc 448 ||||||||||||||||| Sbjct: 1742 gctgccgctggcgctgc 1758 >embl|AE004557|AE004557 Pseudomonas aeruginosa PAO1, section 118 of 529 of the complete genome. Length = 12561 Score = 34.2 bits (17), Expect = 0.36 Identities = 20/21 (95%) Strand = Plus / Plus Query: 262 ctggcgctggcggtgacgctg 282 ||||||||||||| ||||||| Sbjct: 8296 ctggcgctggcggcgacgctg 8316 Score = 30.2 bits (15), Expect = 5.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 264 ggcgctggcggtgacgctg 282 ||||||||||||| ||||| Sbjct: 9590 ggcgctggcggtgccgctg 9608 >embl|AE004541|AE004541 Pseudomonas aeruginosa PAO1, section 102 of 529 of the complete genome. Length = 11840 Score = 34.2 bits (17), Expect = 0.36 Identities = 17/17 (100%) Strand = Plus / Plus Query: 538 cgcaaccagcagggcgc 554 ||||||||||||||||| Sbjct: 5685 cgcaaccagcagggcgc 5701 >embl|AE004506|AE004506 Pseudomonas aeruginosa PAO1, section 67 of 529 of the complete genome. Length = 10007 Score = 34.2 bits (17), Expect = 0.36 Identities = 17/17 (100%) Strand = Plus / Plus Query: 367 accgcgcaccgcatcga 383 ||||||||||||||||| Sbjct: 3104 accgcgcaccgcatcga 3120 >embl|AE004444|AE004444 Pseudomonas aeruginosa PAO1, section 5 of 529 of the complete genome. Length = 10060 Score = 34.2 bits (17), Expect = 0.36 Identities = 17/17 (100%) Strand = Plus / Minus Query: 263 tggcgctggcggtgacg 279 ||||||||||||||||| Sbjct: 7131 tggcgctggcggtgacg 7115 >embl|AE006055|AE006055 Pasteurella multocida subsp. multocida str. Pm70 section 22 of 204 of the complete genome. Length = 10811 Score = 32.2 bits (16), Expect = 1.4 Identities = 19/20 (95%) Strand = Plus / Plus Query: 200 gcgtgatgagcgatgagatc 219 ||||||| |||||||||||| Sbjct: 4921 gcgtgatcagcgatgagatc 4940 >embl|AE004955|AE004955 Pseudomonas aeruginosa PAO1, section 516 of 529 of the complete genome. Length = 10773 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 261 gctggcgctggcggtg 276 |||||||||||||||| Sbjct: 8926 gctggcgctggcggtg 8911 >embl|AE004934|AE004934 Pseudomonas aeruginosa PAO1, section 495 of 529 of the complete genome. Length = 12908 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 262 ctggcgctggcggtga 277 |||||||||||||||| Sbjct: 10194 ctggcgctggcggtga 10179 >embl|AE004914|AE004914 Pseudomonas aeruginosa PAO1, section 475 of 529 of the complete genome. Length = 11650 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 491 ccggcccggcggtgcg 506 |||||||||||||||| Sbjct: 3710 ccggcccggcggtgcg 3725 >embl|AE004879|AE004879 Pseudomonas aeruginosa PAO1, section 440 of 529 of the complete genome. Length = 11086 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 535 tatcgcaaccagcagg 550 |||||||||||||||| Sbjct: 2102 tatcgcaaccagcagg 2117 >embl|AE004873|AE004873 Pseudomonas aeruginosa PAO1, section 434 of 529 of the complete genome. Length = 14053 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 369 cgcgcaccgcatcgat 384 |||||||||||||||| Sbjct: 1856 cgcgcaccgcatcgat 1871 >embl|AE004860|AE004860 Pseudomonas aeruginosa PAO1, section 421 of 529 of the complete genome. Length = 11340 Score = 32.2 bits (16), Expect = 1.4 Identities = 19/20 (95%) Strand = Plus / Minus Query: 430 aagctgccgctggcgctgcg 449 |||||||||||||| ||||| Sbjct: 9178 aagctgccgctggccctgcg 9159 >embl|AE004837|AE004837 Pseudomonas aeruginosa PAO1, section 398 of 529 of the complete genome. Length = 10357 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 432 gctgccgctggcgctg 447 |||||||||||||||| Sbjct: 7075 gctgccgctggcgctg 7090 >embl|AE004823|AE004823 Pseudomonas aeruginosa PAO1, section 384 of 529 of the complete genome. Length = 12800 Score = 32.2 bits (16), Expect = 1.4 Identities = 19/20 (95%) Strand = Plus / Minus Query: 224 tcgacgagggcgaggcgttc 243 |||||||||||| ||||||| Sbjct: 9832 tcgacgagggcggggcgttc 9813 >embl|AE004817|AE004817 Pseudomonas aeruginosa PAO1, section 378 of 529 of the complete genome. Length = 16964 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 432 gctgccgctggcgctg 447 |||||||||||||||| Sbjct: 5189 gctgccgctggcgctg 5204 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 543 ccagcagggcgcggt 557 ||||||||||||||| Sbjct: 16678 ccagcagggcgcggt 16692 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 229 gagggcgaggcgttc 243 ||||||||||||||| Sbjct: 4031 gagggcgaggcgttc 4017 >embl|AE004808|AE004808 Pseudomonas aeruginosa PAO1, section 369 of 529 of the complete genome. Length = 10280 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 408 gctggagttctacaac 423 |||||||||||||||| Sbjct: 5817 gctggagttctacaac 5802 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 307 ctggtgggctggctgg 322 |||||||||||||||| Sbjct: 4016 ctggtgggctggctgg 4001 >embl|AE004767|AE004767 Pseudomonas aeruginosa PAO1, section 328 of 529 of the complete genome. Length = 10344 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 489 ttccggcccggcggtg 504 |||||||||||||||| Sbjct: 2758 ttccggcccggcggtg 2743 >embl|AE004755|AE004755 Pseudomonas aeruginosa PAO1, section 316 of 529 of the complete genome. Length = 14759 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 432 gctgccgctggcgctg 447 |||||||||||||||| Sbjct: 8131 gctgccgctggcgctg 8146 >embl|AE004718|AE004718 Pseudomonas aeruginosa PAO1, section 279 of 529 of the complete genome. Length = 10134 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 434 tgccgctggcgctgcg 449 |||||||||||||||| Sbjct: 4781 tgccgctggcgctgcg 4766 >embl|AE004667|AE004667 Pseudomonas aeruginosa PAO1, section 228 of 529 of the complete genome. Length = 15719 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 430 aagctgccgctggcgc 445 |||||||||||||||| Sbjct: 13676 aagctgccgctggcgc 13661 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 430 aagctgccgctggcgc 445 |||||||||||||||| Sbjct: 6095 aagctgccgctggcgc 6080 >embl|AE004585|AE004585 Pseudomonas aeruginosa PAO1, section 146 of 529 of the complete genome. Length = 10299 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 479 ttgagccgctttccgg 494 |||||||||||||||| Sbjct: 3558 ttgagccgctttccgg 3543 >embl|AE004564|AE004564 Pseudomonas aeruginosa PAO1, section 125 of 529 of the complete genome. Length = 10515 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 496 ccggcggtgcgacctt 511 |||||||||||||||| Sbjct: 438 ccggcggtgcgacctt 453 >embl|AE004486|AE004486 Pseudomonas aeruginosa PAO1, section 47 of 529 of the complete genome. Length = 12874 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 432 gctgccgctggcgctg 447 |||||||||||||||| Sbjct: 2203 gctgccgctggcgctg 2188 >embl|AE004480|AE004480 Pseudomonas aeruginosa PAO1, section 41 of 529 of the complete genome. Length = 10910 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 434 tgccgctggcgctgcg 449 |||||||||||||||| Sbjct: 10380 tgccgctggcgctgcg 10365 >embl|AE004454|AE004454 Pseudomonas aeruginosa PAO1, section 15 of 529 of the complete genome. Length = 11127 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 266 cgctggcggtgacgct 281 |||||||||||||||| Sbjct: 10485 cgctggcggtgacgct 10500 >embl|AE004450|AE004450 Pseudomonas aeruginosa PAO1, section 11 of 529 of the complete genome. Length = 11085 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 232 ggcgaggcgttctatc 247 |||||||||||||||| Sbjct: 6663 ggcgaggcgttctatc 6648 >embl|AE006209|AE006209 Pasteurella multocida subsp. multocida str. Pm70 section 176 of 204 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 517 cgccgtgaagatgcg 531 ||||||||||||||| Sbjct: 6179 cgccgtgaagatgcg 6165 >embl|AE006193|AE006193 Pasteurella multocida subsp. multocida str. Pm70 section 160 of 204 of the complete genome. Length = 10062 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 517 cgccgtgaagatgcg 531 ||||||||||||||| Sbjct: 2100 cgccgtgaagatgcg 2114 >embl|AE006186|AE006186 Pasteurella multocida subsp. multocida str. Pm70 section 153 of 204 of the complete genome. Length = 10699 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 517 cgccgtgaagatgcg 531 ||||||||||||||| Sbjct: 7259 cgccgtgaagatgcg 7273 >embl|AE006130|AE006130 Pasteurella multocida subsp. multocida str. Pm70 section 97 of 204 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 517 cgccgtgaagatgcg 531 ||||||||||||||| Sbjct: 7838 cgccgtgaagatgcg 7824 >embl|AE006082|AE006082 Pasteurella multocida subsp. multocida str. Pm70 section 49 of 204 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 517 cgccgtgaagatgcg 531 ||||||||||||||| Sbjct: 9048 cgccgtgaagatgcg 9062 >embl|AE006065|AE006065 Pasteurella multocida subsp. multocida str. Pm70 section 32 of 204 of the complete genome. Length = 13165 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 517 cgccgtgaagatgcg 531 ||||||||||||||| Sbjct: 6531 cgccgtgaagatgcg 6545 >embl|AE004967|AE004967 Pseudomonas aeruginosa PAO1, section 528 of 529 of the complete genome. Length = 16662 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 437 cgctggcgctgcgtc 451 ||||||||||||||| Sbjct: 15505 cgctggcgctgcgtc 15491 >embl|AE004958|AE004958 Pseudomonas aeruginosa PAO1, section 519 of 529 of the complete genome. Length = 15773 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 270 ggcggtgacgctgga 284 ||||||||||||||| Sbjct: 4514 ggcggtgacgctgga 4500 >embl|AE004943|AE004943 Pseudomonas aeruginosa PAO1, section 504 of 529 of the complete genome. Length = 12834 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 298 ccagccgatctggtg 312 ||||||||||||||| Sbjct: 8788 ccagccgatctggtg 8774 Score = 30.2 bits (15), Expect = 5.7 Identities = 21/23 (91%) Strand = Plus / Minus Query: 306 tctggtgggctggctggacgggc 328 ||||| |||| |||||||||||| Sbjct: 6479 tctggagggccggctggacgggc 6457 >embl|AE004928|AE004928 Pseudomonas aeruginosa PAO1, section 489 of 529 of the complete genome. Length = 11490 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 328 cgttcctcactggcg 342 ||||||||||||||| Sbjct: 5125 cgttcctcactggcg 5139 >embl|AE004922|AE004922 Pseudomonas aeruginosa PAO1, section 483 of 529 of the complete genome. Length = 11099 Score = 30.2 bits (15), Expect = 5.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 370 gcgcaccgcatcgatccgg 388 |||| |||||||||||||| Sbjct: 5486 gcgcgccgcatcgatccgg 5504 >embl|AE004911|AE004911 Pseudomonas aeruginosa PAO1, section 472 of 529 of the complete genome. Length = 12567 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 259 gagctggcgctggcg 273 ||||||||||||||| Sbjct: 2562 gagctggcgctggcg 2548 >embl|AE004889|AE004889 Pseudomonas aeruginosa PAO1, section 450 of 529 of the complete genome. Length = 11415 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 445 ctgcgtccgggcatg 459 ||||||||||||||| Sbjct: 618 ctgcgtccgggcatg 604 >embl|AE004884|AE004884 Pseudomonas aeruginosa PAO1, section 445 of 529 of the complete genome. Length = 13179 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 550 ggcgcggtagccagc 564 ||||||||||||||| Sbjct: 10420 ggcgcggtagccagc 10434 >embl|AE004870|AE004870 Pseudomonas aeruginosa PAO1, section 431 of 529 of the complete genome. Length = 10562 Score = 30.2 bits (15), Expect = 5.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 539 gcaaccagcagggcgcggt 557 |||||||||||| |||||| Sbjct: 5738 gcaaccagcaggacgcggt 5756 >embl|AE004853|AE004853 Pseudomonas aeruginosa PAO1, section 414 of 529 of the complete genome. Length = 11064 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 433 ctgccgctggcgctg 447 ||||||||||||||| Sbjct: 4356 ctgccgctggcgctg 4370 >embl|AE004834|AE004834 Pseudomonas aeruginosa PAO1, section 395 of 529 of the complete genome. Length = 11537 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 431 agctgccgctggcgc 445 ||||||||||||||| Sbjct: 2228 agctgccgctggcgc 2214 >embl|AE004798|AE004798 Pseudomonas aeruginosa PAO1, section 359 of 529 of the complete genome. Length = 17148 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 434 tgccgctggcgctgc 448 ||||||||||||||| Sbjct: 7078 tgccgctggcgctgc 7064 >embl|AE004794|AE004794 Pseudomonas aeruginosa PAO1, section 355 of 529 of the complete genome. Length = 13621 Score = 30.2 bits (15), Expect = 5.7 Identities = 21/23 (91%) Strand = Plus / Minus Query: 261 gctggcgctggcggtgacgctgg 283 |||| ||||||||||| |||||| Sbjct: 2206 gctgccgctggcggtgccgctgg 2184 >embl|AE004791|AE004791 Pseudomonas aeruginosa PAO1, section 352 of 529 of the complete genome. Length = 15476 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 262 ctggcgctggcggtg 276 ||||||||||||||| Sbjct: 11769 ctggcgctggcggtg 11755 >embl|AE004776|AE004776 Pseudomonas aeruginosa PAO1, section 337 of 529 of the complete genome. Length = 11673 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 261 gctggcgctggcggt 275 ||||||||||||||| Sbjct: 3757 gctggcgctggcggt 3743 >embl|AE004773|AE004773 Pseudomonas aeruginosa PAO1, section 334 of 529 of the complete genome. Length = 10822 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 264 ggcgctggcggtgac 278 ||||||||||||||| Sbjct: 2950 ggcgctggcggtgac 2936 >embl|AE004765|AE004765 Pseudomonas aeruginosa PAO1, section 326 of 529 of the complete genome. Length = 9935 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 234 cgaggcgttctatct 248 ||||||||||||||| Sbjct: 6093 cgaggcgttctatct 6079 >embl|AE004719|AE004719 Pseudomonas aeruginosa PAO1, section 280 of 529 of the complete genome. Length = 10145 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 540 caaccagcagggcgc 554 ||||||||||||||| Sbjct: 3246 caaccagcagggcgc 3260 >embl|AE004707|AE004707 Pseudomonas aeruginosa PAO1, section 268 of 529 of the complete genome. Length = 10940 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 200 gcgtgatgagcgatg 214 ||||||||||||||| Sbjct: 5368 gcgtgatgagcgatg 5354 >embl|AE004689|AE004689 Pseudomonas aeruginosa PAO1, section 250 of 529 of the complete genome. Length = 10732 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 263 tggcgctggcggtga 277 ||||||||||||||| Sbjct: 3012 tggcgctggcggtga 2998 >embl|AE004679|AE004679 Pseudomonas aeruginosa PAO1, section 240 of 529 of the complete genome. Length = 10042 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 430 aagctgccgctggcg 444 ||||||||||||||| Sbjct: 4479 aagctgccgctggcg 4493 >embl|AE004673|AE004673 Pseudomonas aeruginosa PAO1, section 234 of 529 of the complete genome. Length = 24397 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 538 cgcaaccagcagggc 552 ||||||||||||||| Sbjct: 13850 cgcaaccagcagggc 13836 >embl|AE004669|AE004669 Pseudomonas aeruginosa PAO1, section 230 of 529 of the complete genome. Length = 22444 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 259 gagctggcgctggcg 273 ||||||||||||||| Sbjct: 16622 gagctggcgctggcg 16636 >embl|AE004648|AE004648 Pseudomonas aeruginosa PAO1, section 209 of 529 of the complete genome. Length = 11031 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 433 ctgccgctggcgctg 447 ||||||||||||||| Sbjct: 583 ctgccgctggcgctg 597 >embl|AE004614|AE004614 Pseudomonas aeruginosa PAO1, section 175 of 529 of the complete genome. Length = 10998 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 435 gccgctggcgctgcg 449 ||||||||||||||| Sbjct: 6626 gccgctggcgctgcg 6640 >embl|AE004612|AE004612 Pseudomonas aeruginosa PAO1, section 173 of 529 of the complete genome. Length = 10385 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 433 ctgccgctggcgctg 447 ||||||||||||||| Sbjct: 3151 ctgccgctggcgctg 3137 >embl|AE004567|AE004567 Pseudomonas aeruginosa PAO1, section 128 of 529 of the complete genome. Length = 11957 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 489 ttccggcccggcggt 503 ||||||||||||||| Sbjct: 808 ttccggcccggcggt 822 >embl|AE004549|AE004549 Pseudomonas aeruginosa PAO1, section 110 of 529 of the complete genome. Length = 10375 Score = 30.2 bits (15), Expect = 5.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 185 gcgccgcgcttgaccgcgt 203 |||| |||||||||||||| Sbjct: 4444 gcgcggcgcttgaccgcgt 4462 >embl|AE004538|AE004538 Pseudomonas aeruginosa PAO1, section 99 of 529 of the complete genome. Length = 10104 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 433 ctgccgctggcgctg 447 ||||||||||||||| Sbjct: 675 ctgccgctggcgctg 689 >embl|AE004530|AE004530 Pseudomonas aeruginosa PAO1, section 91 of 529 of the complete genome. Length = 13263 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 409 ctggagttctacaac 423 ||||||||||||||| Sbjct: 7290 ctggagttctacaac 7304 >embl|AE004492|AE004492 Pseudomonas aeruginosa PAO1, section 53 of 529 of the complete genome. Length = 10211 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 431 agctgccgctggcgc 445 ||||||||||||||| Sbjct: 9995 agctgccgctggcgc 10009 >embl|AE004473|AE004473 Pseudomonas aeruginosa PAO1, section 34 of 529 of the complete genome. Length = 9953 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 33 gcttgatgaaggccg 47 ||||||||||||||| Sbjct: 5269 gcttgatgaaggccg 5283 >embl|AE004466|AE004466 Pseudomonas aeruginosa PAO1, section 27 of 529 of the complete genome. Length = 13409 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 218 tcgttctcgacgagg 232 ||||||||||||||| Sbjct: 7069 tcgttctcgacgagg 7083 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 33 gcttgatgaaggccg 47 ||||||||||||||| Sbjct: 5384 gcttgatgaaggccg 5398 >embl|AE004443|AE004443 Pseudomonas aeruginosa PAO1, section 4 of 529 of the complete genome. Length = 19372 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 538 cgcaaccagcagggc 552 ||||||||||||||| Sbjct: 12050 cgcaaccagcagggc 12064 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 434 tgccgctggcgctgc 448 ||||||||||||||| Sbjct: 9176 tgccgctggcgctgc 9162 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 285 gtcggtgacgctgcc 299 ||||||||||||||| Sbjct: 5065 gtcggtgacgctgcc 5051 >embl|AE004382|AE004382 Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 39 of 93 of the complete chromosome. Length = 11818 Score = 30.2 bits (15), Expect = 5.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 451 ccgggcatgttaattggtg 469 ||||||||||| ||||||| Sbjct: 8527 ccgggcatgttgattggtg 8545 >embl|AE004353|AE004353 Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 10 of 93 of the complete chromosome. Length = 31190 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 171 caaagatgaagtgag 185 ||||||||||||||| Sbjct: 12441 caaagatgaagtgag 12455 >embl|AE004302|AE004302 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 210 of 251 of the complete chromosome. Length = 11036 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 473 tgagctttgagccgc 487 ||||||||||||||| Sbjct: 7157 tgagctttgagccgc 7143 >embl|AE004240|AE004240 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 148 of 251 of the complete chromosome. Length = 14230 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 475 agctttgagccgctt 489 ||||||||||||||| Sbjct: 1090 agctttgagccgctt 1076 >embl|AE004198|AE004198 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 106 of 251 of the complete chromosome. Length = 12918 Score = 30.2 bits (15), Expect = 5.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 228 cgagggcgaggcgtt 242 ||||||||||||||| Sbjct: 3249 cgagggcgaggcgtt 3263 Database: 3g Posted date: Oct 1, 2006 10:39 PM Number of letters in database: 12,619,654 Number of sequences in database: 1077 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7594 Number of Sequences: 1077 Number of extensions: 7594 Number of successful extensions: 85 Number of sequences better than 10.0: 76 Number of HSP's better than 10.0 without gapping: 76 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 85 length of query: 582 length of database: 12,619,654 effective HSP length: 17 effective length of query: 565 effective length of database: 12,601,345 effective search space: 7119759925 effective search space used: 7119759925 T: 0 A: 0 X1: 11 (21.8 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 15 (30.2 bits)