BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= AF052007 AF052007.1 Escherichia coli N-acetylglucosamine-6-phosphate isomerase (nagB), N-acetylglucosamine-6-phosphate deacetylase (nagA), N-acetylglucosamine repressor (nagC), and NagD (nagD) genes, complete cds. (801 letters) Database: pm 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008727 AE006468 |AE008727| Salmonella typhimurium LT2, section... 658 0.0 embl|AE006126|AE006126 Pasteurella multocida subsp. multocida st... 68 3e-11 embl|AE006042|AE006042 Pasteurella multocida subsp. multocida st... 36 0.12 AE012168 AE008922 |AE012168| Xanthomonas campestris pv. campestr... 34 0.49 AE008701 AE006468 |AE008701| Salmonella typhimurium LT2, section... 34 0.49 AE012539 AE008922 |AE012539| Xanthomonas campestris pv. campestr... 32 1.9 AE012492 AE008922 |AE012492| Xanthomonas campestris pv. campestr... 32 1.9 AE012464 AE008922 |AE012464| Xanthomonas campestris pv. campestr... 32 1.9 AE012455 AE008922 |AE012455| Xanthomonas campestris pv. campestr... 32 1.9 AE012356 AE008922 |AE012356| Xanthomonas campestris pv. campestr... 32 1.9 AE012301 AE008922 |AE012301| Xanthomonas campestris pv. campestr... 32 1.9 AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestr... 32 1.9 AE008838 AE006468 |AE008838| Salmonella typhimurium LT2, section... 32 1.9 AE008809 AE006468 |AE008809| Salmonella typhimurium LT2, section... 32 1.9 AE008754 AE006468 |AE008754| Salmonella typhimurium LT2, section... 32 1.9 AE008737 AE006468 AE008738-AE008739 |AE008737| Salmonella typhim... 32 1.9 embl|AE006224|AE006224 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006223|AE006223 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006176|AE006176 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006132|AE006132 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006102|AE006102 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006093|AE006093 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006085|AE006085 Pasteurella multocida subsp. multocida st... 30 7.6 embl|AE006048|AE006048 Pasteurella multocida subsp. multocida st... 30 7.6 AE012534 AE008922 |AE012534| Xanthomonas campestris pv. campestr... 30 7.6 AE012418 AE008922 |AE012418| Xanthomonas campestris pv. campestr... 30 7.6 AE012354 AE008922 |AE012354| Xanthomonas campestris pv. campestr... 30 7.6 AE012332 AE008922 |AE012332| Xanthomonas campestris pv. campestr... 30 7.6 AE008913 AE006468 |AE008913| Salmonella typhimurium LT2, section... 30 7.6 AE008880 AE006468 |AE008880| Salmonella typhimurium LT2, section... 30 7.6 AE008865 AE006468 |AE008865| Salmonella typhimurium LT2, section... 30 7.6 AE008831 AE006468 |AE008831| Salmonella typhimurium LT2, section... 30 7.6 AE008825 AE006468 |AE008825| Salmonella typhimurium LT2, section... 30 7.6 AE008805 AE006468 |AE008805| Salmonella typhimurium LT2, section... 30 7.6 AE008790 AE006468 |AE008790| Salmonella typhimurium LT2, section... 30 7.6 AE008788 AE006468 |AE008788| Salmonella typhimurium LT2, section... 30 7.6 AE008786 AE006468 |AE008786| Salmonella typhimurium LT2, section... 30 7.6 AE008768 AE006468 |AE008768| Salmonella typhimurium LT2, section... 30 7.6 AE008711 AE006468 |AE008711| Salmonella typhimurium LT2, section... 30 7.6 AE008699 AE006468 |AE008699| Salmonella typhimurium LT2, section... 30 7.6 >AE008727 AE006468 |AE008727| Salmonella typhimurium LT2, section 35 of 220 of the complete genome. Length = 22671 Score = 658 bits (332), Expect = 0.0 Identities = 687/804 (85%), Gaps = 6/804 (0%) Strand = Plus / Minus Query: 1 atgagactgatccccctgactaccgctgaacaggtcggcaaatgggctgctcgccatatc 60 ||||||||||||||||||| |||||| |||||||| ||||||||||| |||||||||||| Sbjct: 12266 atgagactgatccccctgagtaccgcagaacaggttggcaaatgggccgctcgccatatc 12207 Query: 61 gtcaatcgtatcaatgcgttcaaaccgactgccgatcgtccgtttgtactgggcctgccg 120 || || ||||| ||||||||||||||||| ||||||||||||||||| || || ||||| Sbjct: 12206 gttaaccgtattaatgcgttcaaaccgaccgccgatcgtccgtttgtccttggactgcct 12147 Query: 121 actggcggcacgccgatgaccacctataaagcgttagtcgaaatgcataaagcaggccag 180 || |||||||||||| | || | || |||||| | || || ||||| ||||| ||| || Sbjct: 12146 accggcggcacgccgctaacggcgtacaaagcgctggttgagatgcacaaagcgggcgag 12087 Query: 181 gtcagctttaagcacgttgtcaccttcaacatgatggacgaatatgtcggtctgccgaaa 240 |||||||||||||| || |||||||| || ||| ||||||||||| || ||||||||| Sbjct: 12086 gtcagctttaagcatgtggtcacctttaatatg---gacgaatatgttggcctgccgaaa 12030 Query: 241 gagcatccggaaagctactacagctttatgcac---aatttcttcgatcacgttgatatt 297 |||||||||||||||||| ||||||||||||| || || |||||||||||||||||| Sbjct: 12029 gagcatccggaaagctaccacagctttatgcatcgtaactttttcgatcacgttgatatt 11970 Query: 298 ccagcagaaaacatcaaccttctcaacggcaacgccccggatatcgacgccgagtgccgc 357 ||||||||||||||||| ||||||||||| ||||| ||||||||||| || || ||||| Sbjct: 11969 ccagcagaaaacatcaatcttctcaacggtaacgcaccggatatcgatgcagaatgccgt 11910 Query: 358 cagtatgaagaaaaaatccgttcttacggaaaaattcatctgtttatgggcggtgtaggt 417 || |||||||||||||| ||||||||||| ||||| ||||||||||||||||| || || Sbjct: 11909 caatatgaagaaaaaattcgttcttacggtaaaatccatctgtttatgggcggcgtcggc 11850 Query: 418 aacgacggtcatattgcatttaacgaaccggcgtcttctctggcttctcgtactcgtatc 477 ||||||||||| || || |||||||||||||||||||| |||||||| || || |||||| Sbjct: 11849 aacgacggtcacatcgcctttaacgaaccggcgtcttccctggcttcccgcacccgtatc 11790 Query: 478 aaaaccctgactcatgacactcgcgtcgcaaactctcgtttctttgataacgatgttaat 537 ||||| | || ||||| |||||||| || ||||| || |||||||| ||| || || Sbjct: 11789 aaaacgttaacccatgatactcgcgtagcgaactcccgcttctttgacggcgacgtaaac 11730 Query: 538 caggtgccaaaatatgccctgactgtcggtgttggtacactgctggatgccgaagaagtg 597 |||||||| ||||| || ||||| || || || ||||| ||||||||||| ||||||||| Sbjct: 11729 caggtgccgaaatacgcgctgacggtaggcgtgggtactctgctggatgcggaagaagtg 11670 Query: 598 atgattctggtgctgggtagccagaaagcactggcgctgcaggccgccgttgaaggttgc 657 ||||||||||||||||| |||||||| | |||||||||||| || |||||||| | Sbjct: 11669 atgattctggtgctgggccatcagaaagcccaggcgctgcaggcggcggttgaaggcaac 11610 Query: 658 gtgaaccatatgtggaccatcagctgtctgcaactgcatccgaaagcgatcatggtgtgc 717 || ||||| ||||||||||| ||||| |||||||| |||||||||||| | |||| ||| Sbjct: 11609 gtcaaccacatgtggaccattagctgcctgcaactccatccgaaagcggttgtggtatgc 11550 Query: 718 gatgaaccttccaccatggagctgaaagttaagactttaagatatttcaatgaattagaa 777 ||||| || ||||| ||||| || |||||||| || || | ||||||||||||||||||| Sbjct: 11549 gatgagccgtccacaatggaacttaaagttaaaacattgaaatatttcaatgaattagaa 11490 Query: 778 gcagaaaatatcaaaggtctgtaa 801 ||||||||||| |||||||||||| Sbjct: 11489 gcagaaaatattaaaggtctgtaa 11466 >embl|AE006126|AE006126 Pasteurella multocida subsp. multocida str. Pm70 section 93 of 204 of the complete genome. Length = 12635 Score = 67.9 bits (34), Expect = 3e-11 Identities = 82/98 (83%) Strand = Plus / Minus Query: 508 aactctcgtttctttgataacgatgttaatcaggtgccaaaatatgccctgactgtcggt 567 ||||| |||||||||||||||||||||||| | ||||| |||||||| || || | ||| Sbjct: 3322 aactcacgtttctttgataacgatgttaataaagtgcctaaatatgcactcaccattggt 3263 Query: 568 gttggtacactgctggatgccgaagaagtgatgattct 605 || || || | || ||||| ||||||||||||||||| Sbjct: 3262 gtggggacgttacttgatgcagaagaagtgatgattct 3225 Score = 50.1 bits (25), Expect = 8e-06 Identities = 73/89 (82%) Strand = Plus / Minus Query: 361 tatgaagaaaaaatccgttcttacggaaaaattcatctgtttatgggcggtgtaggtaac 420 |||||||| |||||| ||||| || ||||||||| | || ||||||||||| ||| Sbjct: 3469 tatgaagagaaaatcaagtcttatggcaaaattcatttattcatgggcggtgttggtgta 3410 Query: 421 gacggtcatattgcatttaacgaaccggc 449 || ||||||||||| ||||| |||||||| Sbjct: 3409 gatggtcatattgcttttaatgaaccggc 3381 >embl|AE006042|AE006042 Pasteurella multocida subsp. multocida str. Pm70 section 9 of 204 of the complete genome. Length = 12736 Score = 36.2 bits (18), Expect = 0.12 Identities = 18/18 (100%) Strand = Plus / Plus Query: 265 tttatgcacaatttcttc 282 |||||||||||||||||| Sbjct: 4017 tttatgcacaatttcttc 4034 >AE012168 AE008922 |AE012168| Xanthomonas campestris pv. campestris str. ATCC 33913, section 76 of 460 of the complete genome. Length = 10029 Score = 34.2 bits (17), Expect = 0.49 Identities = 17/17 (100%) Strand = Plus / Plus Query: 630 ggcgctgcaggccgccg 646 ||||||||||||||||| Sbjct: 9116 ggcgctgcaggccgccg 9132 >AE008701 AE006468 |AE008701| Salmonella typhimurium LT2, section 9 of 220 of the complete genome. Length = 22692 Score = 34.2 bits (17), Expect = 0.49 Identities = 17/17 (100%) Strand = Plus / Plus Query: 588 cgaagaagtgatgattc 604 ||||||||||||||||| Sbjct: 16536 cgaagaagtgatgattc 16552 >AE012539 AE008922 |AE012539| Xanthomonas campestris pv. campestris str. ATCC 33913, section 447 of 460 of the complete genome. Length = 10175 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 631 gcgctgcaggccgccg 646 |||||||||||||||| Sbjct: 723 gcgctgcaggccgccg 738 >AE012492 AE008922 |AE012492| Xanthomonas campestris pv. campestris str. ATCC 33913, section 400 of 460 of the complete genome. Length = 11272 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 629 tggcgctgcaggccgc 644 |||||||||||||||| Sbjct: 7781 tggcgctgcaggccgc 7766 >AE012464 AE008922 |AE012464| Xanthomonas campestris pv. campestris str. ATCC 33913, section 372 of 460 of the complete genome. Length = 11236 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 633 gctgcaggccgccgtt 648 |||||||||||||||| Sbjct: 8488 gctgcaggccgccgtt 8503 >AE012455 AE008922 |AE012455| Xanthomonas campestris pv. campestris str. ATCC 33913, section 363 of 460 of the complete genome. Length = 10276 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 684 tctgcaactgcatccg 699 |||||||||||||||| Sbjct: 1716 tctgcaactgcatccg 1731 >AE012356 AE008922 |AE012356| Xanthomonas campestris pv. campestris str. ATCC 33913, section 264 of 460 of the complete genome. Length = 10623 Score = 32.2 bits (16), Expect = 1.9 Identities = 19/20 (95%) Strand = Plus / Minus Query: 623 aagcactggcgctgcaggcc 642 ||||| |||||||||||||| Sbjct: 2920 aagcattggcgctgcaggcc 2901 >AE012301 AE008922 |AE012301| Xanthomonas campestris pv. campestris str. ATCC 33913, section 209 of 460 of the complete genome. Length = 11381 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 42 atgggctgctcgccat 57 |||||||||||||||| Sbjct: 4297 atgggctgctcgccat 4282 >AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestris str. ATCC 33913, section 13 of 460 of the complete genome. Length = 11990 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 631 gcgctgcaggccgccg 646 |||||||||||||||| Sbjct: 6246 gcgctgcaggccgccg 6231 >AE008838 AE006468 |AE008838| Salmonella typhimurium LT2, section 142 of 220 of the complete genome. Length = 21583 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 759 atatttcaatgaatta 774 |||||||||||||||| Sbjct: 19500 atatttcaatgaatta 19515 >AE008809 AE006468 |AE008809| Salmonella typhimurium LT2, section 113 of 220 of the complete genome. Length = 22803 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 630 ggcgctgcaggccgcc 645 |||||||||||||||| Sbjct: 10597 ggcgctgcaggccgcc 10582 >AE008754 AE006468 |AE008754| Salmonella typhimurium LT2, section 58 of 220 of the complete genome. Length = 24578 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 628 ctggcgctgcaggccg 643 |||||||||||||||| Sbjct: 1746 ctggcgctgcaggccg 1761 >AE008737 AE006468 AE008738-AE008739 |AE008737| Salmonella typhimurium LT2, section 45 of 220 of the complete genome. Length = 65219 Score = 32.2 bits (16), Expect = 1.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 599 tgattctggtgctggg 614 |||||||||||||||| Sbjct: 2215 tgattctggtgctggg 2230 >embl|AE006224|AE006224 Pasteurella multocida subsp. multocida str. Pm70 section 191 of 204 of the complete genome. Length = 11215 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 361 tatgaagaaaaaatc 375 ||||||||||||||| Sbjct: 6090 tatgaagaaaaaatc 6076 >embl|AE006223|AE006223 Pasteurella multocida subsp. multocida str. Pm70 section 190 of 204 of the complete genome. Length = 10227 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 365 aagaaaaaatccgtt 379 ||||||||||||||| Sbjct: 2054 aagaaaaaatccgtt 2068 >embl|AE006176|AE006176 Pasteurella multocida subsp. multocida str. Pm70 section 143 of 204 of the complete genome. Length = 12036 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 782 aaaatatcaaaggtc 796 ||||||||||||||| Sbjct: 1342 aaaatatcaaaggtc 1328 >embl|AE006132|AE006132 Pasteurella multocida subsp. multocida str. Pm70 section 99 of 204 of the complete genome. Length = 11793 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 399 gtttatgggcggtgt 413 ||||||||||||||| Sbjct: 7104 gtttatgggcggtgt 7090 >embl|AE006102|AE006102 Pasteurella multocida subsp. multocida str. Pm70 section 69 of 204 of the complete genome. Length = 12600 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 513 tcgtttctttgataa 527 ||||||||||||||| Sbjct: 3538 tcgtttctttgataa 3552 >embl|AE006093|AE006093 Pasteurella multocida subsp. multocida str. Pm70 section 60 of 204 of the complete genome. Length = 10777 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 758 gatatttcaatgaat 772 ||||||||||||||| Sbjct: 3853 gatatttcaatgaat 3839 >embl|AE006085|AE006085 Pasteurella multocida subsp. multocida str. Pm70 section 52 of 204 of the complete genome. Length = 9960 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 767 atgaattagaagcag 781 ||||||||||||||| Sbjct: 3779 atgaattagaagcag 3793 >embl|AE006048|AE006048 Pasteurella multocida subsp. multocida str. Pm70 section 15 of 204 of the complete genome. Length = 12232 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 722 aaccttccaccatgg 736 ||||||||||||||| Sbjct: 5392 aaccttccaccatgg 5378 >AE012534 AE008922 |AE012534| Xanthomonas campestris pv. campestris str. ATCC 33913, section 442 of 460 of the complete genome. Length = 10039 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 629 tggcgctgcaggccg 643 ||||||||||||||| Sbjct: 9014 tggcgctgcaggccg 9028 >AE012418 AE008922 |AE012418| Xanthomonas campestris pv. campestris str. ATCC 33913, section 326 of 460 of the complete genome. Length = 10118 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 319 ctcaacggcaacgcc 333 ||||||||||||||| Sbjct: 5637 ctcaacggcaacgcc 5651 >AE012354 AE008922 |AE012354| Xanthomonas campestris pv. campestris str. ATCC 33913, section 262 of 460 of the complete genome. Length = 8674 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 346 gccgagtgccgccag 360 ||||||||||||||| Sbjct: 7962 gccgagtgccgccag 7976 >AE012332 AE008922 |AE012332| Xanthomonas campestris pv. campestris str. ATCC 33913, section 240 of 460 of the complete genome. Length = 11470 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 578 tgctggatgccgaag 592 ||||||||||||||| Sbjct: 2321 tgctggatgccgaag 2307 >AE008913 AE006468 |AE008913| Salmonella typhimurium LT2, section 217 of 220 of the complete genome. Length = 23457 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 475 atcaaaaccctgact 489 ||||||||||||||| Sbjct: 10884 atcaaaaccctgact 10870 >AE008880 AE006468 |AE008880| Salmonella typhimurium LT2, section 184 of 220 of the complete genome. Length = 20518 Score = 30.2 bits (15), Expect = 7.6 Identities = 18/19 (94%) Strand = Plus / Plus Query: 121 actggcggcacgccgatga 139 ||||||||||||| ||||| Sbjct: 14719 actggcggcacgcagatga 14737 >AE008865 AE006468 |AE008865| Salmonella typhimurium LT2, section 169 of 220 of the complete genome. Length = 21401 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 598 atgattctggtgctg 612 ||||||||||||||| Sbjct: 7380 atgattctggtgctg 7366 >AE008831 AE006468 |AE008831| Salmonella typhimurium LT2, section 135 of 220 of the complete genome. Length = 20642 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 264 ctttatgcacaattt 278 ||||||||||||||| Sbjct: 2298 ctttatgcacaattt 2312 >AE008825 AE006468 |AE008825| Salmonella typhimurium LT2, section 129 of 220 of the complete genome. Length = 20502 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 520 tttgataacgatgtt 534 ||||||||||||||| Sbjct: 8085 tttgataacgatgtt 8071 >AE008805 AE006468 |AE008805| Salmonella typhimurium LT2, section 109 of 220 of the complete genome. Length = 20518 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 593 aagtgatgattctgg 607 ||||||||||||||| Sbjct: 16848 aagtgatgattctgg 16834 >AE008790 AE006468 |AE008790| Salmonella typhimurium LT2, section 94 of 220 of the complete genome. Length = 20029 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 586 gccgaagaagtgatg 600 ||||||||||||||| Sbjct: 4110 gccgaagaagtgatg 4124 >AE008788 AE006468 |AE008788| Salmonella typhimurium LT2, section 92 of 220 of the complete genome. Length = 23670 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 555 cctgactgtcggtgt 569 ||||||||||||||| Sbjct: 13551 cctgactgtcggtgt 13537 >AE008786 AE006468 |AE008786| Salmonella typhimurium LT2, section 90 of 220 of the complete genome. Length = 22099 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 323 acggcaacgccccgg 337 ||||||||||||||| Sbjct: 8074 acggcaacgccccgg 8060 >AE008768 AE006468 |AE008768| Salmonella typhimurium LT2, section 72 of 220 of the complete genome. Length = 20389 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 139 accacctataaagcg 153 ||||||||||||||| Sbjct: 12265 accacctataaagcg 12279 >AE008711 AE006468 |AE008711| Salmonella typhimurium LT2, section 19 of 220 of the complete genome. Length = 20035 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Minus Query: 737 agctgaaagttaaga 751 ||||||||||||||| Sbjct: 19731 agctgaaagttaaga 19717 >AE008699 AE006468 |AE008699| Salmonella typhimurium LT2, section 7 of 220 of the complete genome. Length = 22348 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 497 ctcgcgtcgcaaact 511 ||||||||||||||| Sbjct: 10914 ctcgcgtcgcaaact 10928 Score = 30.2 bits (15), Expect = 7.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 599 tgattctggtgctgg 613 ||||||||||||||| Sbjct: 20507 tgattctggtgctgg 20521 Database: pm Posted date: Oct 28, 2008 2:30 AM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 108,639 Number of extensions: 6759 Number of successful extensions: 47 Number of sequences better than 10.0: 40 Number of HSP's gapped: 44 Number of HSP's successfully gapped: 44 Length of query: 801 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 784 Effective length of database: 12,228,859 Effective search space: 9587425456 Effective search space used: 9587425456 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 15 (30.2 bits)