BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= U00096 U00096 Escherichia coli str. K-12 substr. MG1655, complete genome. (1215 letters) Database: all 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008815 AE006468 |AE008815| Salmonella typhimurium LT2, section... 1378 0.0 embl|AE006068|AE006068 Pasteurella multocida subsp. multocida st... 74 9e-13 AE012536 AE008922 |AE012536| Xanthomonas campestris pv. campestr... 36 0.19 AE008865 AE006468 |AE008865| Salmonella typhimurium LT2, section... 36 0.19 AE012521 AE008922 |AE012521| Xanthomonas campestris pv. campestr... 34 0.75 AE012160 AE008922 |AE012160| Xanthomonas campestris pv. campestr... 34 0.75 AE012151 AE008922 |AE012151| Xanthomonas campestris pv. campestr... 34 0.75 AE012097 AE008922 |AE012097| Xanthomonas campestris pv. campestr... 34 0.75 AE008907 AE006468 |AE008907| Salmonella typhimurium LT2, section... 34 0.75 AE008898 AE006468 |AE008898| Salmonella typhimurium LT2, section... 34 0.75 AE008730 AE006468 |AE008730| Salmonella typhimurium LT2, section... 34 0.75 AE008704 AE006468 |AE008704| Salmonella typhimurium LT2, section... 34 0.75 embl|AE006231|AE006231 Pasteurella multocida subsp. multocida st... 32 2.9 embl|AE006103|AE006103 Pasteurella multocida subsp. multocida st... 32 2.9 AE012449 AE008922 |AE012449| Xanthomonas campestris pv. campestr... 32 2.9 AE012375 AE008922 |AE012375| Xanthomonas campestris pv. campestr... 32 2.9 AE012274 AE008922 |AE012274| Xanthomonas campestris pv. campestr... 32 2.9 AE012249 AE008922 |AE012249| Xanthomonas campestris pv. campestr... 32 2.9 AE012241 AE008922 |AE012241| Xanthomonas campestris pv. campestr... 32 2.9 AE012234 AE008922 |AE012234| Xanthomonas campestris pv. campestr... 32 2.9 AE012191 AE008922 |AE012191| Xanthomonas campestris pv. campestr... 32 2.9 AE008880 AE006468 |AE008880| Salmonella typhimurium LT2, section... 32 2.9 AE008869 AE006468 |AE008869| Salmonella typhimurium LT2, section... 32 2.9 AE008852 AE006468 |AE008852| Salmonella typhimurium LT2, section... 32 2.9 AE008802 AE006468 |AE008802| Salmonella typhimurium LT2, section... 32 2.9 AE008776 AE006468 |AE008776| Salmonella typhimurium LT2, section... 32 2.9 AE008717 AE006468 |AE008717| Salmonella typhimurium LT2, section... 32 2.9 AE008708 AE006468 |AE008708| Salmonella typhimurium LT2, section... 32 2.9 >AE008815 AE006468 |AE008815| Salmonella typhimurium LT2, section 119 of 220 of the complete genome. Length = 19982 Score = 1378 bits (695), Expect = 0.0 Identities = 1085/1215 (89%) Strand = Plus / Minus Query: 1 atgaaattaccgatttatctcgactactccgcaaccacgccggtggacccgcgtgttgcc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17399 atgaaattaccgatttatctcgactactccgcaaccacgccggtggacccgcgtgttgcc 17340 Query: 61 gagaaaatgatgcagtttatgacgatggacggaacctttggtaacccggcctcccgttct 120 |||||||||||||||||| |||| |||||||||||||||| |||||||| || ||||| Sbjct: 17339 gagaaaatgatgcagtttctgaccctggacggaacctttgggaacccggcgtctcgttca 17280 Query: 121 caccgtttcggctggcaggctgaagaagcggtagatatcgcccgtaatcagattgccgat 180 ||||||||||||||||||||||||||||| || ||||||||||| || |||||||| || Sbjct: 17279 caccgtttcggctggcaggctgaagaagccgtcgatatcgcccgcaaccagattgctgaa 17220 Query: 181 ctggtcggcgctgatccgcgtgaaatcgtctttacctctggtgcaaccgaatctgacaac 240 ||||||||||| || ||||||||||||||||||||||| || || || || ||||| ||| Sbjct: 17219 ctggtcggcgccgacccgcgtgaaatcgtctttacctcaggggcgacggagtctgataac 17160 Query: 241 ctggcgatcaaaggtgcagccaacttttatcagaaaaaaggcaagcacatcatcaccagc 300 |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 17159 ctggcgattaaaggcgctgccaacttttatcagaaaaaaggcaagcacatcatcaccagc 17100 Query: 301 aaaaccgaacacaaagcggtactggatacctgccgtcagctggagcgcgaaggttttgaa 360 || ||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||| Sbjct: 17099 aagaccgagcacaaagcggtgctggacacctgccgtcagcttgagcgcgaagggtttgaa 17040 Query: 361 gtcacctacctggcaccgcagcgtaacggcattatcgacctgaaagaacttgaagcagcg 420 || ||||||||||| |||||||| |||||||| ||||| || || || || ||||||||| Sbjct: 17039 gtgacctacctggcgccgcagcgcaacggcatcatcgatctcaacgagctcgaagcagcg 16980 Query: 421 atgcgtgacgacaccatcctcgtgtccatcatgcacgtaaataacgaaatcggcgtggtg 480 ||||||||||||||||| || || |||||||||||||| || |||||||||||||||||| Sbjct: 16979 atgcgtgacgacaccattctggtttccatcatgcacgtgaacaacgaaatcggcgtggtg 16920 Query: 481 caggatatcgcggctatcggcgaaatgtgccgtgctcgtggcattatctatcacgttgat 540 |||||||||||| | ||||||||||||||||| || || || || ||||| ||||||||| Sbjct: 16919 caggatatcgcgaccatcggcgaaatgtgccgcgcgcgcggtatcatctaccacgttgat 16860 Query: 541 gcaacccagagcgtgggtaaactgcctatcgacctgagccagttgaaagttgacctgatg 600 || |||||||||||||| |||||||||||||| |||||||| ||||||| || |||||| Sbjct: 16859 gccacccagagcgtgggcaaactgcctatcgatctgagccaactgaaagtggatctgatg 16800 Query: 601 tctttctccggtcacaaaatctatggcccgaaaggtatcggtgcgctgtatgtacgtcgt 660 || ||||||||||| ||||| ||||| |||||||| || || ||||||||||| |||||| Sbjct: 16799 tccttctccggtcataaaatttatggtccgaaaggcattggcgcgctgtatgtgcgtcgt 16740 Query: 661 aaaccgcgcgtacgcatcgaagcgcaaatgcacggcggcggtcacgagcgcggtatgcgt 720 || ||||| | ||||| |||||||| ||||| |||||||| ||||| ||||||||||| Sbjct: 16739 aagccgcgtattcgcattgaagcgcagatgcatggcggcgggcacgaacgcggtatgcgc 16680 Query: 721 tccggcactctgcctgttcaccagatcgtcggaatgggcgaggcctatcgcatcgcaaaa 780 || || ||||||||||| |||||||| ||||| |||||||| || || || ||||| ||| Sbjct: 16679 tctggtactctgcctgtccaccagattgtcggcatgggcgaagcttaccgtatcgcgaaa 16620 Query: 781 gaagagatggcgaccgagatggaacgtctgcgcggcctgcgtaaccgtctgtggaacggc 840 |||||||||| |||||| |||| ||||||||||| |||||||||||||||||||||||| Sbjct: 16619 gaagagatggagaccgaaatggcccgtctgcgcggtctgcgtaaccgtctgtggaacggc 16560 Query: 841 atcaaagatatcgaagaagtttacctgaacggtgacctggaacacggtgcgccgaacatt 900 ||||||||||| |||||||||||||||||||| ||||| || || || ||||| |||||| Sbjct: 16559 atcaaagatattgaagaagtttacctgaacggcgaccttgagcagggcgcgccaaacatt 16500 Query: 901 ctcaacgtcagcttcaactacgttgaaggtgagtcgctgattatggcgctgaaagacctc 960 |||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||| Sbjct: 16499 ctcaacgtgagctttaactacgttgaaggcgagtcgctgatcatggcgctgaaagacctg 16440 Query: 961 gcagtttcttcaggttccgcctgtacgtcagcaagcctcgaaccgtcctacgtgctgcgc 1020 || || ||||| ||||||||||| || || || || || |||||||||||||||||||| Sbjct: 16439 gcggtctcttccggttccgcctgcacctccgccagtctggaaccgtcctacgtgctgcgt 16380 Query: 1021 gcgctggggctgaacgacgagctggcacatagctctatccgtttctctttaggtcgtttt 1080 ||| |||| |||| ||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 16379 gcgttgggcatgaatgacgaactggcgcatagctctatccgtttctctttaggtcgtttt 16320 Query: 1081 actactgaagaagagatcgactacaccatcgagttagttcgtaaatccatcggtcgtctg 1140 || |||||||||||||||||||||||||| || | |||||||||||||| || |||||| Sbjct: 16319 accactgaagaagagatcgactacaccattgatctggttcgtaaatccattggccgtctg 16260 Query: 1141 cgtgacctttctccgctgtgggaaatgtacaagcagggcgtggatctgaacagcatcgaa 1200 |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 16259 cgtgacctttctccactgtgggaaatgtacaagcagggtgtggatctgaacagcatcgaa 16200 Query: 1201 tgggctcatcattaa 1215 ||||| ||||||||| Sbjct: 16199 tgggcacatcattaa 16185 >embl|AE006068|AE006068 Pasteurella multocida subsp. multocida str. Pm70 section 35 of 204 of the complete genome. Length = 11223 Score = 73.8 bits (37), Expect = 9e-13 Identities = 214/273 (78%) Strand = Plus / Plus Query: 96 ctttggtaacccggcctcccgttctcaccgtttcggctggcaggctgaagaagcggtaga 155 |||||||||||| ||||||||||| || || ||||||||||| |||||||| || || Sbjct: 677 ctttggtaacccagcctcccgttcacataaatttggctggcaggcagaagaagctgttga 736 Query: 156 tatcgcccgtaatcagattgccgatctggtcggcgctgatccgcgtgaaatcgtctttac 215 | | || ||||| | ||||| ||| || |||| || ||| | ||||| ||||| ||||| Sbjct: 737 tgtggcacgtaactatattgcggatttgatcggggcagattcacgtgagatcgtgtttac 796 Query: 216 ctctggtgcaaccgaatctgacaacctggcgatcaaaggtgcagccaacttttatcagaa 275 ||||||||||||||||| ||||| | || || ||||| || || |||||||||| | Sbjct: 797 gtctggtgcaaccgaatcagacaatttagccattaaaggggctgcgcacttttatcaaag 856 Query: 276 aaaaggcaagcacatcatcaccagcaaaaccgaacacaaagcggtactggatacctgccg 335 ||||| || || || || ||| | ||||| || || ||||| ||| | ||||| || || Sbjct: 857 caaaggtaaacatattattacctgtaaaactgagcataaagctgtattagatacttgtcg 916 Query: 336 tcagctggagcgcgaaggttttgaagtcaccta 368 |||||| ||||| ||||| || ||||| ||||| Sbjct: 917 tcagcttgagcgtgaaggcttcgaagtgaccta 949 Score = 36.2 bits (18), Expect = 0.19 Identities = 78/98 (79%) Strand = Plus / Plus Query: 418 gcgatgcgtgacgacaccatcctcgtgtccatcatgcacgtaaataacgaaatcggcgtg 477 ||||||||||| ||||| || | || || || |||||||| ||||| ||||| || ||| Sbjct: 999 gcgatgcgtgatgacactattttagtttctattatgcacgttaataatgaaattggtgtg 1058 Query: 478 gtgcaggatatcgcggctatcggcgaaatgtgccgtgc 515 | || || || ||||||||||| ||| | |||||||| Sbjct: 1059 attcaagacattgcggctatcggtgaattatgccgtgc 1096 Score = 34.2 bits (17), Expect = 0.75 Identities = 80/101 (79%) Strand = Plus / Plus Query: 691 cacggcggcggtcacgagcgcggtatgcgttccggcactctgcctgttcaccagatcgtc 750 ||||| || ||||| ||||| ||||||||||| || || | ||||| ||||| ||||| Sbjct: 1272 cacggtggtggtcatgagcgtggtatgcgttcaggtaccttacctgtacaccaaatcgtt 1331 Query: 751 ggaatgggcgaggcctatcgcatcgcaaaagaagagatggc 791 || ||||| || || ||||| ||| |||||||| ||||| Sbjct: 1332 ggtatgggtgaagcatatcgtatctgtaaagaagaaatggc 1372 Score = 34.2 bits (17), Expect = 0.75 Identities = 23/25 (92%) Strand = Plus / Plus Query: 908 tcagcttcaactacgttgaaggtga 932 ||||||| ||||| ||||||||||| Sbjct: 1489 tcagctttaactatgttgaaggtga 1513 Score = 32.2 bits (16), Expect = 2.9 Identities = 19/20 (95%) Strand = Plus / Plus Query: 1 atgaaattaccgatttatct 20 ||||||||||| |||||||| Sbjct: 582 atgaaattacctatttatct 601 Score = 32.2 bits (16), Expect = 2.9 Identities = 25/28 (89%) Strand = Plus / Plus Query: 959 tcgcagtttcttcaggttccgcctgtac 986 |||| |||||||||||||| || ||||| Sbjct: 1540 tcgccgtttcttcaggttctgcttgtac 1567 >AE012536 AE008922 |AE012536| Xanthomonas campestris pv. campestris str. ATCC 33913, section 444 of 460 of the complete genome. Length = 10356 Score = 36.2 bits (18), Expect = 0.19 Identities = 18/18 (100%) Strand = Plus / Minus Query: 38 cgccggtggacccgcgtg 55 |||||||||||||||||| Sbjct: 4222 cgccggtggacccgcgtg 4205 >AE008865 AE006468 |AE008865| Salmonella typhimurium LT2, section 169 of 220 of the complete genome. Length = 21401 Score = 36.2 bits (18), Expect = 0.19 Identities = 18/18 (100%) Strand = Plus / Minus Query: 183 ggtcggcgctgatccgcg 200 |||||||||||||||||| Sbjct: 7667 ggtcggcgctgatccgcg 7650 >AE012521 AE008922 |AE012521| Xanthomonas campestris pv. campestris str. ATCC 33913, section 429 of 460 of the complete genome. Length = 10637 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Minus Query: 469 atcggcgtggtgcagga 485 ||||||||||||||||| Sbjct: 9411 atcggcgtggtgcagga 9395 >AE012160 AE008922 |AE012160| Xanthomonas campestris pv. campestris str. ATCC 33913, section 68 of 460 of the complete genome. Length = 10029 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Minus Query: 873 tgacctggaacacggtg 889 ||||||||||||||||| Sbjct: 5686 tgacctggaacacggtg 5670 >AE012151 AE008922 |AE012151| Xanthomonas campestris pv. campestris str. ATCC 33913, section 59 of 460 of the complete genome. Length = 11108 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Plus Query: 1190 acagcatcgaatgggct 1206 ||||||||||||||||| Sbjct: 50 acagcatcgaatgggct 66 >AE012097 AE008922 |AE012097| Xanthomonas campestris pv. campestris str. ATCC 33913, section 5 of 460 of the complete genome. Length = 10564 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Plus Query: 1172 agcagggcgtggatctg 1188 ||||||||||||||||| Sbjct: 9322 agcagggcgtggatctg 9338 >AE008907 AE006468 |AE008907| Salmonella typhimurium LT2, section 211 of 220 of the complete genome. Length = 20029 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Plus Query: 331 tgccgtcagctggagcg 347 ||||||||||||||||| Sbjct: 7912 tgccgtcagctggagcg 7928 >AE008898 AE006468 |AE008898| Salmonella typhimurium LT2, section 202 of 220 of the complete genome. Length = 23880 Score = 34.2 bits (17), Expect = 0.75 Identities = 20/21 (95%) Strand = Plus / Minus Query: 269 atcagaaaaaaggcaagcaca 289 |||||||||||| |||||||| Sbjct: 11681 atcagaaaaaagccaagcaca 11661 >AE008730 AE006468 |AE008730| Salmonella typhimurium LT2, section 38 of 220 of the complete genome. Length = 20941 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Plus Query: 135 gcaggctgaagaagcgg 151 ||||||||||||||||| Sbjct: 17157 gcaggctgaagaagcgg 17173 >AE008704 AE006468 |AE008704| Salmonella typhimurium LT2, section 12 of 220 of the complete genome. Length = 19971 Score = 34.2 bits (17), Expect = 0.75 Identities = 17/17 (100%) Strand = Plus / Minus Query: 168 tcagattgccgatctgg 184 ||||||||||||||||| Sbjct: 15444 tcagattgccgatctgg 15428 >embl|AE006231|AE006231 Pasteurella multocida subsp. multocida str. Pm70 section 198 of 204 of the complete genome. Length = 12179 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 529 tatcacgttgatgcaa 544 |||||||||||||||| Sbjct: 10852 tatcacgttgatgcaa 10837 >embl|AE006103|AE006103 Pasteurella multocida subsp. multocida str. Pm70 section 70 of 204 of the complete genome. Length = 10736 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 403 aaagaacttgaagcag 418 |||||||||||||||| Sbjct: 5663 aaagaacttgaagcag 5678 >AE012449 AE008922 |AE012449| Xanthomonas campestris pv. campestris str. ATCC 33913, section 357 of 460 of the complete genome. Length = 11450 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 175 gccgatctggtcggcg 190 |||||||||||||||| Sbjct: 9118 gccgatctggtcggcg 9103 >AE012375 AE008922 |AE012375| Xanthomonas campestris pv. campestris str. ATCC 33913, section 283 of 460 of the complete genome. Length = 11056 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 175 gccgatctggtcggcg 190 |||||||||||||||| Sbjct: 2201 gccgatctggtcggcg 2216 >AE012274 AE008922 |AE012274| Xanthomonas campestris pv. campestris str. ATCC 33913, section 182 of 460 of the complete genome. Length = 10188 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 754 atgggcgaggcctatc 769 |||||||||||||||| Sbjct: 1111 atgggcgaggcctatc 1126 >AE012249 AE008922 |AE012249| Xanthomonas campestris pv. campestris str. ATCC 33913, section 157 of 460 of the complete genome. Length = 12813 Score = 32.2 bits (16), Expect = 2.9 Identities = 19/20 (95%) Strand = Plus / Minus Query: 332 gccgtcagctggagcgcgaa 351 |||| ||||||||||||||| Sbjct: 10322 gccggcagctggagcgcgaa 10303 >AE012241 AE008922 |AE012241| Xanthomonas campestris pv. campestris str. ATCC 33913, section 149 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1011 cgtgctgcgcgcgctg 1026 |||||||||||||||| Sbjct: 5889 cgtgctgcgcgcgctg 5874 >AE012234 AE008922 |AE012234| Xanthomonas campestris pv. campestris str. ATCC 33913, section 142 of 460 of the complete genome. Length = 11674 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 682 gcgcaaatgcacggcg 697 |||||||||||||||| Sbjct: 2581 gcgcaaatgcacggcg 2596 >AE012191 AE008922 |AE012191| Xanthomonas campestris pv. campestris str. ATCC 33913, section 99 of 460 of the complete genome. Length = 10235 Score = 32.2 bits (16), Expect = 2.9 Identities = 19/20 (95%) Strand = Plus / Plus Query: 694 ggcggcggtcacgagcgcgg 713 |||| ||||||||||||||| Sbjct: 446 ggcgtcggtcacgagcgcgg 465 >AE008880 AE006468 |AE008880| Salmonella typhimurium LT2, section 184 of 220 of the complete genome. Length = 20518 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 561 actgcctatcgacctg 576 |||||||||||||||| Sbjct: 16314 actgcctatcgacctg 16299 >AE008869 AE006468 |AE008869| Salmonella typhimurium LT2, section 173 of 220 of the complete genome. Length = 22072 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1015 ctgcgcgcgctggggc 1030 |||||||||||||||| Sbjct: 14301 ctgcgcgcgctggggc 14286 >AE008852 AE006468 |AE008852| Salmonella typhimurium LT2, section 156 of 220 of the complete genome. Length = 23959 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 567 tatcgacctgagccag 582 |||||||||||||||| Sbjct: 14551 tatcgacctgagccag 14536 >AE008802 AE006468 |AE008802| Salmonella typhimurium LT2, section 106 of 220 of the complete genome. Length = 23759 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1170 caagcagggcgtggat 1185 |||||||||||||||| Sbjct: 9950 caagcagggcgtggat 9935 >AE008776 AE006468 |AE008776| Salmonella typhimurium LT2, section 80 of 220 of the complete genome. Length = 23947 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 313 aaagcggtactggata 328 |||||||||||||||| Sbjct: 9315 aaagcggtactggata 9300 >AE008717 AE006468 |AE008717| Salmonella typhimurium LT2, section 25 of 220 of the complete genome. Length = 20347 Score = 32.2 bits (16), Expect = 2.9 Identities = 19/20 (95%) Strand = Plus / Plus Query: 171 gattgccgatctggtcggcg 190 |||||||| ||||||||||| Sbjct: 7605 gattgccggtctggtcggcg 7624 >AE008708 AE006468 |AE008708| Salmonella typhimurium LT2, section 16 of 220 of the complete genome. Length = 23536 Score = 32.2 bits (16), Expect = 2.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 313 aaagcggtactggata 328 |||||||||||||||| Sbjct: 20677 aaagcggtactggata 20692 Database: all Posted date: Oct 27, 2008 9:57 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 177,202 Number of extensions: 10838 Number of successful extensions: 101 Number of sequences better than 10.0: 28 Number of HSP's gapped: 100 Number of HSP's successfully gapped: 33 Length of query: 1215 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 1198 Effective length of database: 12,228,859 Effective search space: 14650173082 Effective search space used: 14650173082 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 16 (32.2 bits)