BLASTN 2.2.10 [Oct-19-2004]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
         (77 letters)

Database: bs 
           1 sequences; 4,214,630 total letters

Searching.done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosom...    64   2e-11

>AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosome, complete
               sequence.
          Length = 4214630

 Score = 63.9 bits (32), Expect = 2e-11
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                           
Query: 6       agtagcgcagcttggtagcgcaactggtttgggaccagtgggtcggaggttcgaatcctc 65
               |||||| ||||||||||| |||  |||||||||||||  |||||| ||||||||||||| 
Sbjct: 3172164 agtagctcagcttggtagagcacatggtttgggaccatggggtcgcaggttcgaatcctg 3172105

                           
Query: 66      tctcgccgacca 77
               |||  |||||||
Sbjct: 3172104 tcttcccgacca 3172093



 Score = 63.9 bits (32), Expect = 2e-11
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                          
Query: 6      agtagcgcagcttggtagcgcaactggtttgggaccagtgggtcggaggttcgaatcctc 65
              |||||| ||||||||||| |||  |||||||||||||  |||||| ||||||||||||| 
Sbjct: 166172 agtagctcagcttggtagagcacatggtttgggaccatggggtcgcaggttcgaatcctg 166231

                          
Query: 66     tctcgccgacca 77
              |||  |||||||
Sbjct: 166232 tcttcccgacca 166243



 Score = 63.9 bits (32), Expect = 2e-11
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                         
Query: 6     agtagcgcagcttggtagcgcaactggtttgggaccagtgggtcggaggttcgaatcctc 65
             |||||| ||||||||||| |||  |||||||||||||  |||||| ||||||||||||| 
Sbjct: 96062 agtagctcagcttggtagagcacatggtttgggaccatggggtcgcaggttcgaatcctg 96121

                         
Query: 66    tctcgccgacca 77
             |||  |||||||
Sbjct: 96122 tcttcccgacca 96133



 Score = 30.2 bits (15), Expect = 0.21
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 46      ggtcggaggttcgaatcct 64
               ||||| |||||||||||||
Sbjct: 3171148 ggtcgcaggttcgaatcct 3171130



 Score = 30.2 bits (15), Expect = 0.21
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 46     ggtcggaggttcgaatcct 64
              ||||| |||||||||||||
Sbjct: 950959 ggtcgtaggttcgaatcct 950977



 Score = 30.2 bits (15), Expect = 0.21
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 46     ggtcggaggttcgaatcct 64
              ||||| |||||||||||||
Sbjct: 528308 ggtcgcaggttcgaatcct 528326



 Score = 30.2 bits (15), Expect = 0.21
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 46     ggtcggaggttcgaatcct 64
              ||||| |||||||||||||
Sbjct: 165796 ggtcgtaggttcgaatcct 165814



 Score = 28.2 bits (14), Expect = 0.83
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 3       gcgagtagcgcagc 16
               ||||||||||||||
Sbjct: 1349512 gcgagtagcgcagc 1349525



 Score = 26.3 bits (13), Expect = 3.3
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                            
Query: 59      aatcctctctcgc 71
               |||||||||||||
Sbjct: 3936951 aatcctctctcgc 3936963



 Score = 26.3 bits (13), Expect = 3.3
 Identities = 16/17 (94%)
 Strand = Plus / Minus

                                
Query: 47      gtcggaggttcgaatcc 63
               ||||| |||||||||||
Sbjct: 3544946 gtcgggggttcgaatcc 3544930



 Score = 26.3 bits (13), Expect = 3.3
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                           
Query: 54     gttcgaatcctct 66
              |||||||||||||
Sbjct: 755643 gttcgaatcctct 755655



 Score = 26.3 bits (13), Expect = 3.3
 Identities = 13/13 (100%)
 Strand = Plus / Minus

                           
Query: 9      agcgcagcttggt 21
              |||||||||||||
Sbjct: 726164 agcgcagcttggt 726152


  Database: bs
    Posted date:  Sep 30, 2006  1:58 PM
  Number of letters in database: 4,214,630
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 74
Number of Sequences: 1
Number of extensions: 74
Number of successful extensions: 12
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 12
length of query: 77
length of database: 4,214,630
effective HSP length: 14
effective length of query: 63
effective length of database: 4,214,616
effective search space: 265520808
effective search space used: 265520808
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)