BLASTN 2.2.10 [Oct-19-2004] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= BAB96698 (1551 letters) Database: 3posl 1077 sequences; 12,619,654 total letters Searching...done Score E Sequences producing significant alignments: (bits) Value embl|AE004614|AE004614 Pseudomonas aeruginosa PAO1, section 175 ... 38 0.063 embl|AE004535|AE004535 Pseudomonas aeruginosa PAO1, section 96 o... 36 0.25 embl|AE004710|AE004710 Pseudomonas aeruginosa PAO1, section 271 ... 34 0.98 embl|AE004586|AE004586 Pseudomonas aeruginosa PAO1, section 147 ... 34 0.98 embl|AE006230|AE006230 Pasteurella multocida subsp. multocida st... 32 3.9 embl|AE006220|AE006220 Pasteurella multocida subsp. multocida st... 32 3.9 embl|AE004961|AE004961 Pseudomonas aeruginosa PAO1, section 522 ... 32 3.9 embl|AE004924|AE004924 Pseudomonas aeruginosa PAO1, section 485 ... 32 3.9 embl|AE004877|AE004877 Pseudomonas aeruginosa PAO1, section 438 ... 32 3.9 embl|AE004872|AE004872 Pseudomonas aeruginosa PAO1, section 433 ... 32 3.9 embl|AE004858|AE004858 Pseudomonas aeruginosa PAO1, section 419 ... 32 3.9 embl|AE004844|AE004844 Pseudomonas aeruginosa PAO1, section 405 ... 32 3.9 embl|AE004822|AE004822 Pseudomonas aeruginosa PAO1, section 383 ... 32 3.9 embl|AE004778|AE004778 Pseudomonas aeruginosa PAO1, section 339 ... 32 3.9 embl|AE004728|AE004728 Pseudomonas aeruginosa PAO1, section 289 ... 32 3.9 embl|AE004725|AE004725 Pseudomonas aeruginosa PAO1, section 286 ... 32 3.9 embl|AE004715|AE004715 Pseudomonas aeruginosa PAO1, section 276 ... 32 3.9 embl|AE004579|AE004579 Pseudomonas aeruginosa PAO1, section 140 ... 32 3.9 embl|AE004575|AE004575 Pseudomonas aeruginosa PAO1, section 136 ... 32 3.9 embl|AE004561|AE004561 Pseudomonas aeruginosa PAO1, section 122 ... 32 3.9 embl|AE004558|AE004558 Pseudomonas aeruginosa PAO1, section 119 ... 32 3.9 embl|AE004488|AE004488 Pseudomonas aeruginosa PAO1, section 49 o... 32 3.9 embl|AE004314|AE004314 Vibrio cholerae O1 biovar eltor str. N169... 32 3.9 embl|AE004117|AE004117 Vibrio cholerae O1 biovar eltor str. N169... 32 3.9 >embl|AE004614|AE004614 Pseudomonas aeruginosa PAO1, section 175 of 529 of the complete genome. Length = 10998 Score = 38.2 bits (19), Expect = 0.063 Identities = 19/19 (100%) Strand = Plus / Minus Query: 400 cctgccgctacctgctggt 418 ||||||||||||||||||| Sbjct: 5221 cctgccgctacctgctggt 5203 >embl|AE004535|AE004535 Pseudomonas aeruginosa PAO1, section 96 of 529 of the complete genome. Length = 11431 Score = 36.2 bits (18), Expect = 0.25 Identities = 18/18 (100%) Strand = Plus / Minus Query: 604 gtgatgaccgccgccgtg 621 |||||||||||||||||| Sbjct: 1496 gtgatgaccgccgccgtg 1479 >embl|AE004710|AE004710 Pseudomonas aeruginosa PAO1, section 271 of 529 of the complete genome. Length = 11873 Score = 34.2 bits (17), Expect = 0.98 Identities = 17/17 (100%) Strand = Plus / Minus Query: 332 tcgacggcggcccgcag 348 ||||||||||||||||| Sbjct: 2393 tcgacggcggcccgcag 2377 >embl|AE004586|AE004586 Pseudomonas aeruginosa PAO1, section 147 of 529 of the complete genome. Length = 15358 Score = 34.2 bits (17), Expect = 0.98 Identities = 17/17 (100%) Strand = Plus / Plus Query: 31 gtcgcgctgggtgtggc 47 ||||||||||||||||| Sbjct: 4448 gtcgcgctgggtgtggc 4464 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1113 tggcgatcaggcgatg 1128 |||||||||||||||| Sbjct: 5206 tggcgatcaggcgatg 5221 >embl|AE006230|AE006230 Pasteurella multocida subsp. multocida str. Pm70 section 197 of 204 of the complete genome. Length = 10325 Score = 32.2 bits (16), Expect = 3.9 Identities = 25/28 (89%) Strand = Plus / Minus Query: 1227 aatcaacggtcaggcgtttgatatgaac 1254 |||||||||||| | |||||||||||| Sbjct: 7027 aatcaacggtcaaacctttgatatgaac 7000 >embl|AE006220|AE006220 Pasteurella multocida subsp. multocida str. Pm70 section 187 of 204 of the complete genome. Length = 13709 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 704 tgctcaatggctgtaa 719 |||||||||||||||| Sbjct: 7104 tgctcaatggctgtaa 7089 >embl|AE004961|AE004961 Pseudomonas aeruginosa PAO1, section 522 of 529 of the complete genome. Length = 10766 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 691 ctgcgcctgcgtttgc 706 |||||||||||||||| Sbjct: 3073 ctgcgcctgcgtttgc 3088 >embl|AE004924|AE004924 Pseudomonas aeruginosa PAO1, section 485 of 529 of the complete genome. Length = 11101 Score = 32.2 bits (16), Expect = 3.9 Identities = 19/20 (95%) Strand = Plus / Plus Query: 1114 ggcgatcaggcgatggccgg 1133 |||||||||||| ||||||| Sbjct: 1757 ggcgatcaggcgctggccgg 1776 >embl|AE004877|AE004877 Pseudomonas aeruginosa PAO1, section 438 of 529 of the complete genome. Length = 10479 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 679 ccgcgtggttggctgc 694 |||||||||||||||| Sbjct: 8982 ccgcgtggttggctgc 8967 >embl|AE004872|AE004872 Pseudomonas aeruginosa PAO1, section 433 of 529 of the complete genome. Length = 10256 Score = 32.2 bits (16), Expect = 3.9 Identities = 19/20 (95%) Strand = Plus / Minus Query: 601 gatgtgatgaccgccgccgt 620 |||| ||||||||||||||| Sbjct: 4435 gatgcgatgaccgccgccgt 4416 >embl|AE004858|AE004858 Pseudomonas aeruginosa PAO1, section 419 of 529 of the complete genome. Length = 10487 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 747 cgacaatcgcccgctg 762 |||||||||||||||| Sbjct: 8382 cgacaatcgcccgctg 8367 >embl|AE004844|AE004844 Pseudomonas aeruginosa PAO1, section 405 of 529 of the complete genome. Length = 17712 Score = 32.2 bits (16), Expect = 3.9 Identities = 19/20 (95%) Strand = Plus / Plus Query: 401 ctgccgctacctgctggttc 420 ||||||||||| |||||||| Sbjct: 8015 ctgccgctacccgctggttc 8034 >embl|AE004822|AE004822 Pseudomonas aeruginosa PAO1, section 383 of 529 of the complete genome. Length = 10935 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 844 gaagtgctggtggagg 859 |||||||||||||||| Sbjct: 2531 gaagtgctggtggagg 2516 >embl|AE004778|AE004778 Pseudomonas aeruginosa PAO1, section 339 of 529 of the complete genome. Length = 11589 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1122 ggcgatggccgggatg 1137 |||||||||||||||| Sbjct: 4381 ggcgatggccgggatg 4366 >embl|AE004728|AE004728 Pseudomonas aeruginosa PAO1, section 289 of 529 of the complete genome. Length = 10982 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 892 ctgccggtcagccaga 907 |||||||||||||||| Sbjct: 2165 ctgccggtcagccaga 2150 >embl|AE004725|AE004725 Pseudomonas aeruginosa PAO1, section 286 of 529 of the complete genome. Length = 10218 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1026 gctggaagggctgacg 1041 |||||||||||||||| Sbjct: 8105 gctggaagggctgacg 8090 >embl|AE004715|AE004715 Pseudomonas aeruginosa PAO1, section 276 of 529 of the complete genome. Length = 10189 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 401 ctgccgctacctgctg 416 |||||||||||||||| Sbjct: 8654 ctgccgctacctgctg 8669 >embl|AE004579|AE004579 Pseudomonas aeruginosa PAO1, section 140 of 529 of the complete genome. Length = 15265 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1122 ggcgatggccgggatg 1137 |||||||||||||||| Sbjct: 8517 ggcgatggccgggatg 8502 >embl|AE004575|AE004575 Pseudomonas aeruginosa PAO1, section 136 of 529 of the complete genome. Length = 10679 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 817 ctgccggtgctgatgg 832 |||||||||||||||| Sbjct: 3410 ctgccggtgctgatgg 3425 >embl|AE004561|AE004561 Pseudomonas aeruginosa PAO1, section 122 of 529 of the complete genome. Length = 10757 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 393 tgatcaacctgccgct 408 |||||||||||||||| Sbjct: 609 tgatcaacctgccgct 624 >embl|AE004558|AE004558 Pseudomonas aeruginosa PAO1, section 119 of 529 of the complete genome. Length = 9917 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 464 ggctggctgggctggt 479 |||||||||||||||| Sbjct: 3627 ggctggctgggctggt 3642 >embl|AE004488|AE004488 Pseudomonas aeruginosa PAO1, section 49 of 529 of the complete genome. Length = 11403 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Minus Query: 403 gccgctacctgctggt 418 |||||||||||||||| Sbjct: 10623 gccgctacctgctggt 10608 >embl|AE004314|AE004314 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 222 of 251 of the complete chromosome. Length = 10061 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 593 atcaactggatgtgat 608 |||||||||||||||| Sbjct: 2461 atcaactggatgtgat 2476 >embl|AE004117|AE004117 Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 25 of 251 of the complete chromosome. Length = 10883 Score = 32.2 bits (16), Expect = 3.9 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1254 caagccgatgtttgcg 1269 |||||||||||||||| Sbjct: 1585 caagccgatgtttgcg 1600 Database: 3posl Posted date: Nov 9, 2006 11:05 PM Number of letters in database: 12,619,654 Number of sequences in database: 1077 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 14,747 Number of Sequences: 1077 Number of extensions: 14747 Number of successful extensions: 25 Number of sequences better than 10.0: 24 Number of HSP's better than 10.0 without gapping: 24 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 25 length of query: 1551 length of database: 12,619,654 effective HSP length: 17 effective length of query: 1534 effective length of database: 12,601,345 effective search space: 19330463230 effective search space used: 19330463230 T: 0 A: 0 X1: 11 (21.8 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 16 (32.2 bits)