MEGABLAST 2.2.10 [Oct-19-2004]


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), 
"A greedy algorithm for aligning DNA sequences", 
J Comput Biol 2000; 7(1-2):203-14.

Database: bs 
           1 sequences; 4,214,630 total letters

Searching. done
Query= ECOLI U00096 Escherichia coli K-12, complete genome.
         (77 letters)



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosom...   103   2e-23

>AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosome,
             complete sequence.
          Length = 4214630

 Score =  103 bits (52), Expect = 2e-23
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                         
Query: 6     tgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaagtccac 65
             |||||||||| |||||||||||||| ||||||||| |||||||||||||||| |||||||
Sbjct: 31935 tgtagctcagctggttagagcgcacgcctgataagcgtgaggtcggtggttcgagtccac 31994

                         
Query: 66    tcaggcctacca 77
             ||||||| ||||
Sbjct: 31995 tcaggcccacca 32006



 Score =  103 bits (52), Expect = 2e-23
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                         
Query: 6     tgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaagtccac 65
             |||||||||| |||||||||||||| ||||||||| |||||||||||||||| |||||||
Sbjct: 11467 tgtagctcagctggttagagcgcacgcctgataagcgtgaggtcggtggttcgagtccac 11526

                         
Query: 66    tcaggcctacca 77
             ||||||| ||||
Sbjct: 11527 tcaggcccacca 11538



 Score = 87.7 bits (44), Expect = 1e-18
 Identities = 65/72 (90%)
 Strand = Plus / Minus

                                                                           
Query: 6       tgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaagtccac 65
               |||||||||| |||||||||||||| ||||||||| ||||||||| |||||| |||||| 
Sbjct: 3171273 tgtagctcagctggttagagcgcacgcctgataagcgtgaggtcgatggttcgagtccat 3171214

                           
Query: 66      tcaggcctacca 77
               ||||||| ||||
Sbjct: 3171213 tcaggcccacca 3171202



 Score = 28.2 bits (14), Expect = 0.82
 Identities = 20/22 (90%)
 Strand = Plus / Minus

                                     
Query: 6       tgtagctcaggtggttagagcg 27
               |||||||||| ||| |||||||
Sbjct: 3171989 tgtagctcagctggctagagcg 3171968



 Score = 24.3 bits (12), Expect =    13
 Identities = 15/16 (93%)
 Strand = Plus / Minus

                               
Query: 42      gtgaggtcggtggttc 57
               |||||||||| |||||
Sbjct: 3171953 gtgaggtcgggggttc 3171938


  Database: bs
    Posted date:  Sep 26, 2006  7:09 PM
  Number of letters in database: 4,214,630
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 0, Extension: 0
Number of Hits to DB: 16
Number of Sequences: 1
Number of extensions: 5
Number of successful extensions: 5
Number of sequences better than 1000.0: 1
Number of HSP's better than 1000.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 0
length of query: 77
length of database: 4,214,630
effective HSP length: 15
effective length of query: 62
effective length of database: 4,214,615
effective search space: 261306130
effective search space used:        0
S2: 9 (18.3 bits)