BLASTN 2.2.10 [Oct-19-2004] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome. (76 letters) Database: bs 21 sequences; 4,215,470 total letters Searching.done Score E Sequences producing significant alignments: (bits) Value Z99119 Z99119 Bacillus subtilis complete genome (section 16 of 2... 105 4e-24 Z99104 Z99104 Bacillus subtilis complete genome (section 1 of 21... 105 4e-24 Z99110 Z99110 Bacillus subtilis complete genome (section 7 of 21... 40 2e-04 Z99108 Z99108 Bacillus subtilis complete genome (section 5 of 21... 36 0.003 Z99109 Z99109 Bacillus subtilis complete genome (section 6 of 21... 34 0.013 Z99121 Z99121 Bacillus subtilis complete genome (section 18 of 2... 28 0.82 Z99116 Z99116 Bacillus subtilis complete genome (section 13 of 2... 28 0.82 Z99124 Z99124 Bacillus subtilis complete genome (section 21 of 2... 26 3.2 Z99122 Z99122 Bacillus subtilis complete genome (section 19 of 2... 26 3.2 Z99107 Z99107 Bacillus subtilis complete genome (section 4 of 21... 26 3.2 Z99106 Z99106 Bacillus subtilis complete genome (section 3 of 21... 26 3.2 Z99105 Z99105 Bacillus subtilis complete genome (section 2 of 21... 26 3.2 >Z99119 Z99119 Bacillus subtilis complete genome (section 16 of 21): from 3013458 to 3213379. Length = 199922 Score = 105 bits (53), Expect = 4e-24 Identities = 56/57 (98%) Strand = Plus / Minus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgc 64 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 158623 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc 158567 Score = 46.1 bits (23), Expect = 3e-06 Identities = 26/27 (96%) Strand = Plus / Minus Query: 1 ggggctatagctcagctgggagagcgc 27 ||||| ||||||||||||||||||||| Sbjct: 180109 ggggccatagctcagctgggagagcgc 180083 Score = 40.1 bits (20), Expect = 2e-04 Identities = 47/56 (83%) Strand = Plus / Minus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccg 63 |||||||||||||||||| |||| || || |||| |||| ||||||||| |||| Sbjct: 159380 tagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagcccg 159325 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Minus Query: 36 cacgcaggaggtc 48 ||||||||||||| Sbjct: 158142 cacgcaggaggtc 158130 >Z99104 Z99104 Bacillus subtilis complete genome (section 1 of 21): from 1 to 213080. Length = 213080 Score = 105 bits (53), Expect = 4e-24 Identities = 56/57 (98%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgc 64 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 166259 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc 166315 Score = 105 bits (53), Expect = 4e-24 Identities = 56/57 (98%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgc 64 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 96150 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc 96206 Score = 105 bits (53), Expect = 4e-24 Identities = 56/57 (98%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgc 64 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 32025 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc 32081 Score = 105 bits (53), Expect = 4e-24 Identities = 56/57 (98%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgc 64 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 11557 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc 11613 Score = 40.1 bits (20), Expect = 2e-04 Identities = 47/56 (83%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccg 63 |||||||||||||||||| |||| || || |||| |||| ||||||||| |||| Sbjct: 194279 tagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagcccg 194334 Score = 40.1 bits (20), Expect = 2e-04 Identities = 47/56 (83%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccg 63 |||||||||||||||||| |||| || || |||| |||| ||||||||| |||| Sbjct: 95379 tagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagcccg 95434 >Z99110 Z99110 Bacillus subtilis complete genome (section 7 of 21): from 1209742 to 1410982. Length = 201241 Score = 40.1 bits (20), Expect = 2e-04 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 tagctcagctgggagagcgc 27 |||||||||||||||||||| Sbjct: 52367 tagctcagctgggagagcgc 52386 >Z99108 Z99108 Bacillus subtilis complete genome (section 5 of 21): from 813670 to 1011078. Length = 197409 Score = 36.2 bits (18), Expect = 0.003 Identities = 18/18 (100%) Strand = Plus / Plus Query: 8 tagctcagctgggagagc 25 |||||||||||||||||| Sbjct: 137541 tagctcagctgggagagc 137558 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Plus Query: 36 cacgcaggaggtc 48 ||||||||||||| Sbjct: 137743 cacgcaggaggtc 137755 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Plus Query: 34 tgcacgcaggagg 46 ||||||||||||| Sbjct: 38457 tgcacgcaggagg 38469 >Z99109 Z99109 Bacillus subtilis complete genome (section 6 of 21): from 1011039 to 1209781. Length = 198743 Score = 34.2 bits (17), Expect = 0.013 Identities = 17/17 (100%) Strand = Plus / Plus Query: 51 cggttcgatcccgcata 67 ||||||||||||||||| Sbjct: 153018 cggttcgatcccgcata 153034 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Plus Query: 13 cagctgggagagc 25 ||||||||||||| Sbjct: 154763 cagctgggagagc 154775 >Z99121 Z99121 Bacillus subtilis complete genome (section 18 of 21): from 3414339 to 3609030. Length = 194692 Score = 28.2 bits (14), Expect = 0.82 Identities = 14/14 (100%) Strand = Plus / Plus Query: 13 cagctgggagagcg 26 |||||||||||||| Sbjct: 69386 cagctgggagagcg 69399 >Z99116 Z99116 Bacillus subtilis complete genome (section 13 of 21): from 2409151 to 2613687. Length = 204537 Score = 28.2 bits (14), Expect = 0.82 Identities = 14/14 (100%) Strand = Plus / Minus Query: 6 tatagctcagctgg 19 |||||||||||||| Sbjct: 34610 tatagctcagctgg 34597 >Z99124 Z99124 Bacillus subtilis complete genome (section 21 of 21): from 4010730 to 4214630. Length = 203901 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Minus Query: 36 cacgcaggaggtc 48 ||||||||||||| Sbjct: 143229 cacgcaggaggtc 143217 >Z99122 Z99122 Bacillus subtilis complete genome (section 19 of 21): from 3608981 to 3809670. Length = 200690 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Plus Query: 28 ctgctttgcacgc 40 ||||||||||||| Sbjct: 70943 ctgctttgcacgc 70955 >Z99107 Z99107 Bacillus subtilis complete genome (section 4 of 21): from 611631 to 813719. Length = 202089 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Plus Query: 36 cacgcaggaggtc 48 ||||||||||||| Sbjct: 28358 cacgcaggaggtc 28370 >Z99106 Z99106 Bacillus subtilis complete genome (section 3 of 21): from 415769 to 611680. Length = 195912 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Plus Query: 12 tcagctgggagag 24 ||||||||||||| Sbjct: 126288 tcagctgggagag 126300 >Z99105 Z99105 Bacillus subtilis complete genome (section 2 of 21): from 213031 to 415798. Length = 202768 Score = 26.3 bits (13), Expect = 3.2 Identities = 13/13 (100%) Strand = Plus / Minus Query: 39 gcaggaggtctgc 51 ||||||||||||| Sbjct: 125358 gcaggaggtctgc 125346 Database: bs Posted date: Oct 4, 2006 1:45 PM Number of letters in database: 4,215,470 Number of sequences in database: 21 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 120 Number of Sequences: 21 Number of extensions: 120 Number of successful extensions: 23 Number of sequences better than 10.0: 12 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 23 length of query: 76 length of database: 4,215,470 effective HSP length: 14 effective length of query: 62 effective length of database: 4,215,176 effective search space: 261340912 effective search space used: 261340912 T: 0 A: 0 X1: 11 (21.8 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 13 (26.3 bits)