MEGABLAST 2.2.10 [Oct-19-2004]
Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
"A greedy algorithm for aligning DNA sequences",
J Comput Biol 2000; 7(1-2):203-14.
Database: bs
21 sequences; 4,215,470 total letters
Searching. done
Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
(76 letters)
Score E
Sequences producing significant alignments: (bits) Value
Z99104 Z99104 Bacillus subtilis complete genome (section 1 of 21... 113 2e-26
Z99119 Z99119 Bacillus subtilis complete genome (section 16 of 2... 109 3e-25
Z99110 Z99110 Bacillus subtilis complete genome (section 7 of 21... 40 2e-04
Z99108 Z99108 Bacillus subtilis complete genome (section 5 of 21... 36 0.003
>Z99104 Z99104 Bacillus subtilis complete genome (section 1 of 21): from 1
to 213080.
Length = 213080
Score = 113 bits (57), Expect = 2e-26
Identities = 67/70 (95%), Gaps = 2/70 (2%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgcata 67
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||
Sbjct: 166259 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc-ta 166317
Query: 68 g-ctccacca 76
| ||||||||
Sbjct: 166318 ggctccacca 166327
Score = 113 bits (57), Expect = 2e-26
Identities = 67/70 (95%), Gaps = 2/70 (2%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgcata 67
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||
Sbjct: 96150 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc-ta 96208
Query: 68 g-ctccacca 76
| ||||||||
Sbjct: 96209 ggctccacca 96218
Score = 113 bits (57), Expect = 2e-26
Identities = 67/70 (95%), Gaps = 2/70 (2%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgcata 67
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||
Sbjct: 32025 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc-ta 32083
Query: 68 g-ctccacca 76
| ||||||||
Sbjct: 32084 ggctccacca 32093
Score = 113 bits (57), Expect = 2e-26
Identities = 67/70 (95%), Gaps = 2/70 (2%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgcata 67
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||
Sbjct: 11557 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc-ta 11615
Query: 68 g-ctccacca 76
| ||||||||
Sbjct: 11616 ggctccacca 11625
Score = 42.1 bits (21), Expect = 5e-05
Identities = 59/71 (83%), Gaps = 4/71 (5%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggagg-tctgcggttcgatcccg-ca 65
|||||||||||||||||| |||| || || |||| ||| || ||||||||| |||| ||
Sbjct: 194279 tagctcagctgggagagcatctgccttacaagcag-agggtcggcggttcgagcccgtca 194337
Query: 66 tagctccacca 76
| ||||||||
Sbjct: 194338 tc-ctccacca 194347
Score = 42.1 bits (21), Expect = 5e-05
Identities = 59/71 (83%), Gaps = 4/71 (5%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggagg-tctgcggttcgatcccg-ca 65
|||||||||||||||||| |||| || || |||| ||| || ||||||||| |||| ||
Sbjct: 95379 tagctcagctgggagagcatctgccttacaagcag-agggtcggcggttcgagcccgtca 95437
Query: 66 tagctccacca 76
| ||||||||
Sbjct: 95438 tc-ctccacca 95447
>Z99119 Z99119 Bacillus subtilis complete genome (section 16 of 21): from
3013458 to 3213379.
Length = 199922
Score = 109 bits (55), Expect = 3e-25
Identities = 65/68 (95%), Gaps = 2/68 (2%)
Strand = Plus / Minus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgcata 67
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||
Sbjct: 158623 tagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgc-ta 158565
Query: 68 g-ctccac 74
| ||||||
Sbjct: 158564 ggctccac 158557
Score = 46.1 bits (23), Expect = 3e-06
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 1 ggggctatagctcagctgggagagcgc 27
||||| |||||||||||||||||||||
Sbjct: 180109 ggggccatagctcagctgggagagcgc 180083
Score = 42.1 bits (21), Expect = 5e-05
Identities = 59/71 (83%), Gaps = 4/71 (5%)
Strand = Plus / Minus
Query: 8 tagctcagctgggagagcgcctgctttgcacgcaggagg-tctgcggttcgatcccg-ca 65
|||||||||||||||||| |||| || || |||| ||| || ||||||||| |||| ||
Sbjct: 159380 tagctcagctgggagagcatctgccttacaagcag-agggtcggcggttcgagcccgtca 159322
Query: 66 tagctccacca 76
| ||||||||
Sbjct: 159321 tc-ctccacca 159312
>Z99110 Z99110 Bacillus subtilis complete genome (section 7 of 21): from
1209742 to 1410982.
Length = 201241
Score = 40.1 bits (20), Expect = 2e-04
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagcgc 27
||||||||||||||||||||
Sbjct: 52367 tagctcagctgggagagcgc 52386
>Z99108 Z99108 Bacillus subtilis complete genome (section 5 of 21): from
813670 to 1011078.
Length = 197409
Score = 36.2 bits (18), Expect = 0.003
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 8 tagctcagctgggagagc 25
||||||||||||||||||
Sbjct: 137541 tagctcagctgggagagc 137558
Database: bs
Posted date: Oct 4, 2006 1:45 PM
Number of letters in database: 4,215,470
Number of sequences in database: 21
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 0, Extension: 0
Number of Hits to DB: 66
Number of Sequences: 21
Number of extensions: 12
Number of successful extensions: 12
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 0
length of query: 76
length of database: 4,215,470
effective HSP length: 15
effective length of query: 61
effective length of database: 4,215,155
effective search space: 257124455
effective search space used: 0
S2: 13 (26.3 bits)