BLASTN 2.2.25 [Feb-01-2011] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= AP009048 AP009048.1 Escherichia coli str. K12 substr. W3110 DNA, complete genome. (1047 letters) Database: st 220 sequences; 4,870,572 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008750 AE006468 Salmonella typhimurium LT2, section 54 of 220 ... 488 e-138 AE008855 AE006468 Salmonella typhimurium LT2, section 159 of 220... 36 0.065 AE008834 AE006468 Salmonella typhimurium LT2, section 138 of 220... 34 0.26 AE008903 AE006468 Salmonella typhimurium LT2, section 207 of 220... 32 1.0 AE008737 AE006468 AE008738-AE008739 Salmonella typhimurium LT2, ... 32 1.0 AE008897 AE006468 Salmonella typhimurium LT2, section 201 of 220... 30 4.0 AE008890 AE006468 Salmonella typhimurium LT2, section 194 of 220... 30 4.0 AE008877 AE006468 Salmonella typhimurium LT2, section 181 of 220... 30 4.0 AE008866 AE006468 Salmonella typhimurium LT2, section 170 of 220... 30 4.0 AE008865 AE006468 Salmonella typhimurium LT2, section 169 of 220... 30 4.0 AE008859 AE006468 Salmonella typhimurium LT2, section 163 of 220... 30 4.0 AE008852 AE006468 Salmonella typhimurium LT2, section 156 of 220... 30 4.0 AE008846 AE006468 Salmonella typhimurium LT2, section 150 of 220... 30 4.0 AE008845 AE006468 Salmonella typhimurium LT2, section 149 of 220... 30 4.0 AE008842 AE006468 Salmonella typhimurium LT2, section 146 of 220... 30 4.0 AE008839 AE006468 Salmonella typhimurium LT2, section 143 of 220... 30 4.0 AE008821 AE006468 Salmonella typhimurium LT2, section 125 of 220... 30 4.0 AE008816 AE006468 Salmonella typhimurium LT2, section 120 of 220... 30 4.0 AE008802 AE006468 Salmonella typhimurium LT2, section 106 of 220... 30 4.0 AE008793 AE006468 Salmonella typhimurium LT2, section 97 of 220 ... 30 4.0 AE008788 AE006468 Salmonella typhimurium LT2, section 92 of 220 ... 30 4.0 AE008787 AE006468 Salmonella typhimurium LT2, section 91 of 220 ... 30 4.0 AE008786 AE006468 Salmonella typhimurium LT2, section 90 of 220 ... 30 4.0 AE008757 AE006468 Salmonella typhimurium LT2, section 61 of 220 ... 30 4.0 AE008741 AE006468 Salmonella typhimurium LT2, section 47 of 220 ... 30 4.0 AE008735 AE006468 Salmonella typhimurium LT2, section 43 of 220 ... 30 4.0 AE008734 AE006468 Salmonella typhimurium LT2, section 42 of 220 ... 30 4.0 AE008732 AE006468 Salmonella typhimurium LT2, section 40 of 220 ... 30 4.0 AE008725 AE006468 Salmonella typhimurium LT2, section 33 of 220 ... 30 4.0 AE008724 AE006468 Salmonella typhimurium LT2, section 32 of 220 ... 30 4.0 AE008711 AE006468 Salmonella typhimurium LT2, section 19 of 220 ... 30 4.0 AE008703 AE006468 Salmonella typhimurium LT2, section 11 of 220 ... 30 4.0 AE008702 AE006468 Salmonella typhimurium LT2, section 10 of 220 ... 30 4.0 AE008696 AE006468 Salmonella typhimurium LT2, section 4 of 220 o... 30 4.0 >AE008750 AE006468 Salmonella typhimurium LT2, section 54 of 220 of the complete genome. Length = 20396 Score = 488 bits (246), Expect = e-138 Identities = 747/914 (81%) Strand = Plus / Minus Query: 1 atgactgcaccatcccaggtattaaagatccgccgcccagacgactggcaccttcacctc 60 |||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||| Sbjct: 13349 atgactgcaccatcccaggttttaaagatccgccgcccggacgactggcacgttcacctt 13290 Query: 61 cgcgatggcgacatgttaaaaactgtcgtgccatataccagcgaaatttatggacgggct 120 ||||||||||||||||||||||| ||||| || |||||||||||||||||||| || ||| Sbjct: 13289 cgcgatggcgacatgttaaaaacggtcgtaccctataccagcgaaatttatggtcgcgct 13230 Query: 121 atcgtaatgcccaatctggctccgcccgtgaccaccgttgaggctgccgtggcgtatcgc 180 ||||| ||||| || ||||| | ||| | || |||||||| || || | || || ||| Sbjct: 13229 atcgtgatgccgaacctggcgtcccccatcacgaccgttgatgcagcgatcgcctaccgc 13170 Query: 181 cagcgtattcttgacgccgtacctgccgggcacgatttcaccccattgatgacctgttat 240 ||||||||||| || || || || |||||||| |||||||| || || |||||||| ||| Sbjct: 13169 cagcgtattctcgatgcggtgcccgccgggcatgatttcacgccgttaatgacctgctat 13110 Query: 241 ttaacagattcgctggatcctaatgagctggagcgcggatttaacgaaggcgtgttcacc 300 ||||| |||||||| ||| | |||| |||||||| || || | |||||||| || || Sbjct: 13109 ttaacggattcgctcgatgccgatgaactggagcgtggtttccatgaaggcgtatttact 13050 Query: 301 gctgcaaaactttacccggcaaacgcaaccactaactccagccacggcgtgacgtcaatt 360 || || || ||||||||||| || || |||||||||||||| || ||||| |||||| | Sbjct: 13049 gcggctaagctttacccggccaatgccaccactaactccagtcatggcgtaacgtcagtc 12990 Query: 361 gacgcaatcatgccggtacttgagcgcatggaaaaaatcggtatgccgctactggtgcat 420 ||||| |||||||||||||| ||||| ||||||||| |||| || || | ||||| || Sbjct: 12989 gacgctatcatgccggtactggagcggatggaaaaactcggaataccattgctggtccac 12930 Query: 421 ggtgaagtgacacatgcagatatcgacatttttgatcgtgaagcgcgctttatagaaagc 480 || || ||||| ||||| ||| | || || || |||||||||||||| ||||| || | | Sbjct: 12929 ggggaggtgacccatgcggatgttgatatattcgatcgtgaagcgcgttttatcgacacc 12870 Query: 481 gtgatggaacctctgcgccagcgcctgactgcgctgaaagtcgtttttgagcacatcacc 540 || |||||||| || |||||||| ||||| ||||| ||||| || |||||||||||||| Sbjct: 12869 gtaatggaaccgctacgccagcgtctgaccgcgcttaaagtggtctttgagcacatcacg 12810 Query: 541 accaaagatgctgccgactatgtccgtgacggaaatgaacggctggctgccaccatcact 600 ||||||||||| || | ||||| |||||||| || || ||||| || ||||| || Sbjct: 12809 accaaagatgccgcgcagtatgtacgtgacggcaacgactacctggcggctaccattacg 12750 Query: 601 ccgcagcatctgatgtttaaccgcaaccatatgctggttggaggcgtgcgtccgcacctg 660 || || ||| | ||||||||||| || |||||||||| || ||| | ||||| |||||| Sbjct: 12749 cctcaacatttaatgtttaaccgtaatgatatgctggtcggcggcattcgtcctcacctg 12690 Query: 661 tattgtctacccatcctcaaacgtaatattcaccaacaggcattgcgtgaactggtcgcc 720 || ||||| || || || ||||| ||||||||||| ||||| || || |||||||| ||| Sbjct: 12689 tactgtctgccgattctgaaacgcaatattcaccagcaggcgttacgcgaactggttgcc 12630 Query: 721 agcggttttaatcgagtattcctcggtacggattctgcgccacatgcacgtcatcgcaaa 780 || ||||||| || | ||||| || |||||||| ||||| ||| |||||||||| ||| Sbjct: 12629 agtggttttacgcgcgccttcctggggacggattcagcgccgcattcacgtcatcgtaaa 12570 Query: 781 gagagcagttgcggctgcgcgggctgcttcaacgccccaaccgcgctgggcagttacgct 840 |||| ||||||||||||||| || || ||||||||||| |||| || |||||||| || Sbjct: 12569 gagaccagttgcggctgcgccggttgtttcaacgccccctccgcccttggcagttatgcc 12510 Query: 841 accgtctttgaagaaatgaatgctttgcagcactttgaagcattctgttctgtaaacggc 900 |||| ||||| |||||||| || || |||||||||||| |||||||| | || ||| Sbjct: 12509 gccgtgtttgaggaaatgaacgcgctggcgcactttgaagcgttctgttcactgaatggc 12450 Query: 901 ccgcagttctatgg 914 ||||| |||||||| Sbjct: 12449 ccgcaattctatgg 12436 >AE008855 AE006468 Salmonella typhimurium LT2, section 159 of 220 of the complete genome. Length = 21252 Score = 36.2 bits (18), Expect = 0.065 Identities = 21/22 (95%) Strand = Plus / Plus Query: 338 ccagccacggcgtgacgtcaat 359 ||||||||||| |||||||||| Sbjct: 10415 ccagccacggcttgacgtcaat 10436 >AE008834 AE006468 Salmonella typhimurium LT2, section 138 of 220 of the complete genome. Length = 20029 Score = 34.2 bits (17), Expect = 0.26 Identities = 17/17 (100%) Strand = Plus / Plus Query: 288 aggcgtgttcaccgctg 304 ||||||||||||||||| Sbjct: 8815 aggcgtgttcaccgctg 8831 >AE008903 AE006468 Salmonella typhimurium LT2, section 207 of 220 of the complete genome. Length = 20869 Score = 32.2 bits (16), Expect = 1.0 Identities = 16/16 (100%) Strand = Plus / Plus Query: 493 ctgcgccagcgcctga 508 |||||||||||||||| Sbjct: 2546 ctgcgccagcgcctga 2561 >AE008737 AE006468 AE008738-AE008739 Salmonella typhimurium LT2, section 45 of 220 of the complete genome. Length = 65219 Score = 32.2 bits (16), Expect = 1.0 Identities = 16/16 (100%) Strand = Plus / Minus Query: 146 ccgtgaccaccgttga 161 |||||||||||||||| Sbjct: 63506 ccgtgaccaccgttga 63491 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 16 caggtattaaagatc 30 ||||||||||||||| Sbjct: 37741 caggtattaaagatc 37755 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 493 ctgcgccagcgcctg 507 ||||||||||||||| Sbjct: 47823 ctgcgccagcgcctg 47837 >AE008897 AE006468 Salmonella typhimurium LT2, section 201 of 220 of the complete genome. Length = 20409 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 577 gaacggctggctgcc 591 ||||||||||||||| Sbjct: 10545 gaacggctggctgcc 10531 >AE008890 AE006468 Salmonella typhimurium LT2, section 194 of 220 of the complete genome. Length = 21582 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 398 tcggtatgccgctac 412 ||||||||||||||| Sbjct: 10885 tcggtatgccgctac 10899 >AE008877 AE006468 Salmonella typhimurium LT2, section 181 of 220 of the complete genome. Length = 22492 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 340 agccacggcgtgacg 354 ||||||||||||||| Sbjct: 7422 agccacggcgtgacg 7436 >AE008866 AE006468 Salmonella typhimurium LT2, section 170 of 220 of the complete genome. Length = 20516 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 828 gggcagttacgctac 842 ||||||||||||||| Sbjct: 1870 gggcagttacgctac 1884 >AE008865 AE006468 Salmonella typhimurium LT2, section 169 of 220 of the complete genome. Length = 21401 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 601 ccgcagcatctgatg 615 ||||||||||||||| Sbjct: 18127 ccgcagcatctgatg 18141 >AE008859 AE006468 Salmonella typhimurium LT2, section 163 of 220 of the complete genome. Length = 23069 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 482 tgatggaacctctgc 496 ||||||||||||||| Sbjct: 19413 tgatggaacctctgc 19427 >AE008852 AE006468 Salmonella typhimurium LT2, section 156 of 220 of the complete genome. Length = 23959 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 337 tccagccacggcgtg 351 ||||||||||||||| Sbjct: 22777 tccagccacggcgtg 22763 >AE008846 AE006468 Salmonella typhimurium LT2, section 150 of 220 of the complete genome. Length = 21003 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 319 gcaaacgcaaccact 333 ||||||||||||||| Sbjct: 3195 gcaaacgcaaccact 3209 >AE008845 AE006468 Salmonella typhimurium LT2, section 149 of 220 of the complete genome. Length = 23018 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 301 gctgcaaaactttac 315 ||||||||||||||| Sbjct: 2125 gctgcaaaactttac 2111 >AE008842 AE006468 Salmonella typhimurium LT2, section 146 of 220 of the complete genome. Length = 22204 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 496 cgccagcgcctgact 510 ||||||||||||||| Sbjct: 12993 cgccagcgcctgact 13007 >AE008839 AE006468 Salmonella typhimurium LT2, section 143 of 220 of the complete genome. Length = 22400 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 965 ttgctgaaagcatcg 979 ||||||||||||||| Sbjct: 20259 ttgctgaaagcatcg 20245 >AE008821 AE006468 Salmonella typhimurium LT2, section 125 of 220 of the complete genome. Length = 21387 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 337 tccagccacggcgtg 351 ||||||||||||||| Sbjct: 19673 tccagccacggcgtg 19659 >AE008816 AE006468 Salmonella typhimurium LT2, section 120 of 220 of the complete genome. Length = 22690 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 544 aaagatgctgccgac 558 ||||||||||||||| Sbjct: 15176 aaagatgctgccgac 15162 >AE008802 AE006468 Salmonella typhimurium LT2, section 106 of 220 of the complete genome. Length = 23759 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 626 accatatgctggttg 640 ||||||||||||||| Sbjct: 11152 accatatgctggttg 11138 >AE008793 AE006468 Salmonella typhimurium LT2, section 97 of 220 of the complete genome. Length = 20148 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 305 caaaactttacccgg 319 ||||||||||||||| Sbjct: 11183 caaaactttacccgg 11169 >AE008788 AE006468 Salmonella typhimurium LT2, section 92 of 220 of the complete genome. Length = 23670 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 389 tggaaaaaatcggta 403 ||||||||||||||| Sbjct: 6875 tggaaaaaatcggta 6861 >AE008787 AE006468 Salmonella typhimurium LT2, section 91 of 220 of the complete genome. Length = 24186 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 710 aactggtcgccagcg 724 ||||||||||||||| Sbjct: 11767 aactggtcgccagcg 11753 >AE008786 AE006468 Salmonella typhimurium LT2, section 90 of 220 of the complete genome. Length = 22099 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 207 cgggcacgatttcac 221 ||||||||||||||| Sbjct: 9019 cgggcacgatttcac 9005 >AE008757 AE006468 Salmonella typhimurium LT2, section 61 of 220 of the complete genome. Length = 21149 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 33 ccgcccagacgactg 47 ||||||||||||||| Sbjct: 9752 ccgcccagacgactg 9766 >AE008741 AE006468 Salmonella typhimurium LT2, section 47 of 220 of the complete genome. Length = 25409 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 715 gtcgccagcggtttt 729 ||||||||||||||| Sbjct: 22549 gtcgccagcggtttt 22535 >AE008735 AE006468 Salmonella typhimurium LT2, section 43 of 220 of the complete genome. Length = 21697 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 709 gaactggtcgccagc 723 ||||||||||||||| Sbjct: 13877 gaactggtcgccagc 13891 >AE008734 AE006468 Salmonella typhimurium LT2, section 42 of 220 of the complete genome. Length = 21522 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 715 gtcgccagcggtttt 729 ||||||||||||||| Sbjct: 1462 gtcgccagcggtttt 1448 >AE008732 AE006468 Salmonella typhimurium LT2, section 40 of 220 of the complete genome. Length = 22407 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 501 gcgcctgactgcgct 515 ||||||||||||||| Sbjct: 22092 gcgcctgactgcgct 22106 >AE008725 AE006468 Salmonella typhimurium LT2, section 33 of 220 of the complete genome. Length = 24057 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 262 aatgagctggagcgc 276 ||||||||||||||| Sbjct: 16361 aatgagctggagcgc 16347 >AE008724 AE006468 Salmonella typhimurium LT2, section 32 of 220 of the complete genome. Length = 26720 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 439 gatatcgacattttt 453 ||||||||||||||| Sbjct: 11331 gatatcgacattttt 11317 >AE008711 AE006468 Salmonella typhimurium LT2, section 19 of 220 of the complete genome. Length = 20035 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 711 actggtcgccagcgg 725 ||||||||||||||| Sbjct: 9171 actggtcgccagcgg 9157 >AE008703 AE006468 Salmonella typhimurium LT2, section 11 of 220 of the complete genome. Length = 20269 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 717 cgccagcggttttaa 731 ||||||||||||||| Sbjct: 9481 cgccagcggttttaa 9467 >AE008702 AE006468 Salmonella typhimurium LT2, section 10 of 220 of the complete genome. Length = 21072 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 863 ctttgcagcactttg 877 ||||||||||||||| Sbjct: 4652 ctttgcagcactttg 4638 >AE008696 AE006468 Salmonella typhimurium LT2, section 4 of 220 of the complete genome. Length = 22039 Score = 30.2 bits (15), Expect = 4.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 30 ccgccgcccagacga 44 ||||||||||||||| Sbjct: 3648 ccgccgcccagacga 3662 Database: st Posted date: Dec 26, 2011 11:05 PM Number of letters in database: 4,870,572 Number of sequences in database: 220 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 220 Number of Hits to DB: 65,197 Number of extensions: 40 Number of successful extensions: 40 Number of sequences better than 10.0: 34 Number of HSP's gapped: 37 Number of HSP's successfully gapped: 37 Length of query: 1047 Length of database: 4,870,572 Length adjustment: 16 Effective length of query: 1031 Effective length of database: 4,867,052 Effective search space: 5017930612 Effective search space used: 5017930612 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 50 (99.1 bits) S1: 15 (30.2 bits) S2: 15 (30.2 bits)