BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= U00006 ppc gene Phosphoenolpiruvate carboxilase (PEPCase)(ec 4.1.1.31)(pepc) AC UniProt CAPP_ECOLI (2652 letters) Database: 3g 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008892 AE006468 |AE008892| Salmonella typhimurium LT2, section... 2095 0.0 embl|AE006090|AE006090 Pasteurella multocida subsp. multocida st... 52 7e-06 AE012116 AE008922 |AE012116| Xanthomonas campestris pv. campestr... 44 0.002 AE008808 AE006468 |AE008808| Salmonella typhimurium LT2, section... 38 0.11 AE008881 AE006468 |AE008881| Salmonella typhimurium LT2, section... 36 0.42 AE008724 AE006468 |AE008724| Salmonella typhimurium LT2, section... 36 0.42 AE012314 AE008922 |AE012314| Xanthomonas campestris pv. campestr... 36 0.42 AE012305 AE008922 |AE012305| Xanthomonas campestris pv. campestr... 36 0.42 AE012294 AE008922 |AE012294| Xanthomonas campestris pv. campestr... 36 0.42 AE012171 AE008922 |AE012171| Xanthomonas campestris pv. campestr... 36 0.42 embl|AE006199|AE006199 Pasteurella multocida subsp. multocida st... 34 1.6 AE008908 AE006468 |AE008908| Salmonella typhimurium LT2, section... 34 1.6 AE008900 AE006468 |AE008900| Salmonella typhimurium LT2, section... 34 1.6 AE008877 AE006468 |AE008877| Salmonella typhimurium LT2, section... 34 1.6 AE008794 AE006468 |AE008794| Salmonella typhimurium LT2, section... 34 1.6 AE012473 AE008922 |AE012473| Xanthomonas campestris pv. campestr... 34 1.6 embl|AE006209|AE006209 Pasteurella multocida subsp. multocida st... 32 6.5 embl|AE006109|AE006109 Pasteurella multocida subsp. multocida st... 32 6.5 AE008914 AE006468 |AE008914| Salmonella typhimurium LT2, section... 32 6.5 AE008872 AE006468 |AE008872| Salmonella typhimurium LT2, section... 32 6.5 AE008867 AE006468 |AE008867| Salmonella typhimurium LT2, section... 32 6.5 AE008859 AE006468 |AE008859| Salmonella typhimurium LT2, section... 32 6.5 AE008858 AE006468 |AE008858| Salmonella typhimurium LT2, section... 32 6.5 AE008853 AE006468 |AE008853| Salmonella typhimurium LT2, section... 32 6.5 AE008835 AE006468 |AE008835| Salmonella typhimurium LT2, section... 32 6.5 AE008809 AE006468 |AE008809| Salmonella typhimurium LT2, section... 32 6.5 AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section... 32 6.5 AE008791 AE006468 |AE008791| Salmonella typhimurium LT2, section... 32 6.5 AE008773 AE006468 |AE008773| Salmonella typhimurium LT2, section... 32 6.5 AE008766 AE006468 |AE008766| Salmonella typhimurium LT2, section... 32 6.5 AE008755 AE006468 |AE008755| Salmonella typhimurium LT2, section... 32 6.5 AE008737 AE006468 AE008738-AE008739 |AE008737| Salmonella typhim... 32 6.5 AE008718 AE006468 |AE008718| Salmonella typhimurium LT2, section... 32 6.5 AE008717 AE006468 |AE008717| Salmonella typhimurium LT2, section... 32 6.5 AE008702 AE006468 |AE008702| Salmonella typhimurium LT2, section... 32 6.5 AE008701 AE006468 |AE008701| Salmonella typhimurium LT2, section... 32 6.5 AE012531 AE008922 |AE012531| Xanthomonas campestris pv. campestr... 32 6.5 AE012482 AE008922 |AE012482| Xanthomonas campestris pv. campestr... 32 6.5 AE012481 AE008922 |AE012481| Xanthomonas campestris pv. campestr... 32 6.5 AE012480 AE008922 |AE012480| Xanthomonas campestris pv. campestr... 32 6.5 AE012476 AE008922 |AE012476| Xanthomonas campestris pv. campestr... 32 6.5 AE012456 AE008922 |AE012456| Xanthomonas campestris pv. campestr... 32 6.5 AE012392 AE008922 |AE012392| Xanthomonas campestris pv. campestr... 32 6.5 AE012391 AE008922 |AE012391| Xanthomonas campestris pv. campestr... 32 6.5 AE012387 AE008922 |AE012387| Xanthomonas campestris pv. campestr... 32 6.5 AE012372 AE008922 |AE012372| Xanthomonas campestris pv. campestr... 32 6.5 AE012358 AE008922 |AE012358| Xanthomonas campestris pv. campestr... 32 6.5 AE012346 AE008922 |AE012346| Xanthomonas campestris pv. campestr... 32 6.5 AE012343 AE008922 |AE012343| Xanthomonas campestris pv. campestr... 32 6.5 AE012326 AE008922 |AE012326| Xanthomonas campestris pv. campestr... 32 6.5 AE012322 AE008922 |AE012322| Xanthomonas campestris pv. campestr... 32 6.5 AE012310 AE008922 |AE012310| Xanthomonas campestris pv. campestr... 32 6.5 AE012296 AE008922 |AE012296| Xanthomonas campestris pv. campestr... 32 6.5 AE012289 AE008922 |AE012289| Xanthomonas campestris pv. campestr... 32 6.5 AE012284 AE008922 |AE012284| Xanthomonas campestris pv. campestr... 32 6.5 AE012268 AE008922 |AE012268| Xanthomonas campestris pv. campestr... 32 6.5 AE012229 AE008922 |AE012229| Xanthomonas campestris pv. campestr... 32 6.5 AE012217 AE008922 |AE012217| Xanthomonas campestris pv. campestr... 32 6.5 AE012181 AE008922 |AE012181| Xanthomonas campestris pv. campestr... 32 6.5 AE012180 AE008922 |AE012180| Xanthomonas campestris pv. campestr... 32 6.5 AE012177 AE008922 |AE012177| Xanthomonas campestris pv. campestr... 32 6.5 AE012157 AE008922 |AE012157| Xanthomonas campestris pv. campestr... 32 6.5 AE012144 AE008922 |AE012144| Xanthomonas campestris pv. campestr... 32 6.5 AE012112 AE008922 |AE012112| Xanthomonas campestris pv. campestr... 32 6.5 AE012104 AE008922 |AE012104| Xanthomonas campestris pv. campestr... 32 6.5 >AE008892 AE006468 |AE008892| Salmonella typhimurium LT2, section 196 of 220 of the complete genome. Length = 20385 Score = 2095 bits (1057), Expect = 0.0 Identities = 2170/2541 (85%) Strand = Plus / Minus Query: 1 atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcggcaaagtgctggga 60 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| Sbjct: 15358 atgaacgaacaatattccgcgttgcgtagtaatgtcagtatgctcggcaaggtgctggga 15299 Query: 61 gaaaccatcaaggatgcgttgggagaacacattcttgaacgcgtagaaactatccgtaag 120 |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 15298 gaaaccatcaaggatgcgctgggagaacacattcttgatcgcgtagaaacaatccgtaag 15239 Query: 121 ttgtcgaaatcttcacgcgctggcaatgatgctaaccgccaggagttgctcaccacctta 180 | || |||||||||||||| |||||||| ||||| ||||||||| |||||||||| || Sbjct: 15238 ctatccaaatcttcacgcgccggcaatgaagctaatcgccaggagctgctcaccacgcta 15179 Query: 181 caaaatttgtcgaacgacgagctgctgcccgttgcgcgtgcgtttagtcagttcctgaac 240 ||||||||||| || |||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 15178 caaaatttgtctaatgacgagctgctgccagttgcgcgcgcgtttagtcagttcctgaac 15119 Query: 241 ctggccaacaccgccgagcaataccacagcatttcgccgaaaggcgaagctgccagcaac 300 |||||||| || |||||||||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 15118 ctggccaatactgccgagcaataccacagcatttcgccaaaaggcgaagccgccagcaac 15059 Query: 301 ccggaagtgatcgcccgcaccctgcgtaaactgaaaaaccagccggaactgagcgaagac 360 ||||||||||| |||||||| ||||| |||||||||||||| ||||| || | ||| | Sbjct: 15058 ccggaagtgattgcccgcactctgcgcaaactgaaaaaccaaccggacctcaacgacgca 14999 Query: 361 accatcaaaaaagcagtggaatcgctgtcgctggaactggtcctcacggctcacccaacc 420 |||||||||||||| || || |||||||| ||||| |||| || || || || || || Sbjct: 14998 accatcaaaaaagcggtagagtcgctgtctctggagttggtgctaaccgcccatccgaca 14939 Query: 421 gaaattacccgtcgtacactgatccacaaaatggtggaagtgaacgcctgtttaaaacag 480 ||||||||||| ||||| || || |||||||||| ||| | ||| |||| |||||||| Sbjct: 14938 gaaattacccgccgtacgcttattcacaaaatgggtgaaatcaacaactgtctaaaacag 14879 Query: 481 ctcgataacaaagatatcgctgactacgaacacaaccagctgatgcgtcgcctgcgccag 540 || ||||| | |||||||| |||||||||| | ||||| | |||||||||||||||||| Sbjct: 14878 cttgataataccgatatcgccgactacgaacgccaccaggtaatgcgtcgcctgcgccag 14819 Query: 541 ttgatcgcccagtcatggcataccgatgaaatccgtaagctgcgtccaagcccggtagat 600 ||||| ||||| || |||||||| ||||| ||||| |||| ||||||||||||||| ||| Sbjct: 14818 ttgattgcccaatcctggcatacggatgagatccgcaagcagcgtccaagcccggtggat 14759 Query: 601 gaagccaaatggggctttgccgtagtggaaaacagcctgtggcaaggcgtaccaaattac 660 ||||||||||||||||| ||||| || || |||||||||||||| |||||||| || || Sbjct: 14758 gaagccaaatggggcttcgccgtggttgagaacagcctgtggcagggcgtacctaactat 14699 Query: 661 ctgcgcgaactgaacgaacaactggaagagaacctcggctacaaactgcccgtcgaattt 720 ||||| |||||||||||||| |||||||| || |||||||||||| |||| || || ||| Sbjct: 14698 ctgcgtgaactgaacgaacagctggaagaaaatctcggctacaaattgccggtggatttt 14639 Query: 721 gttccggtccgttttacttcgtggatgggcggcgaccgcgacggcaacccgaacgtcact 780 || ||||| |||||||| || ||||||||||||||||| ||||||||||||||||| || Sbjct: 14638 gtgccggtacgttttacctcctggatgggcggcgaccgtgacggcaacccgaacgtgacg 14579 Query: 781 gccgatatcacccgccacgtcctgctactcagccgctggaaagccaccgatttgttcctg 840 || ||||||||||||||||| || | | ||||||||||||||||||||| |||||||| Sbjct: 14578 gcggatatcacccgccacgtactcttgttaagccgctggaaagccaccgatctgttcctg 14519 Query: 841 aaagatattcaggtgctggtttctgaactgtcgatggttgaagcgacccctgaactgctg 900 ||||| ||||| || ||||| || |||||||||||||| || || || || || |||||| Sbjct: 14518 aaagacattcatgttctggtatcagaactgtcgatggtcgacgccacgccggagctgctg 14459 Query: 901 gcgctggttggcgaagaaggtgccgcagaaccgtatcgctatctgatgaaaaacctgcgt 960 ||| | || ||||||||||| || | || ||||||||||| ||||||||||| |||| Sbjct: 14458 gcgttagtgggcgaagaaggcgcgtctgagccgtatcgctacctgatgaaaaaattgcgc 14399 Query: 961 tctcgcctgatggcgacacaggcatggctggaagcgcgcctgaaaggcgaagaactgcca 1020 | || ||||||||||| ||| | |||||||||||||| ||||||||||| | ||||| Sbjct: 14398 gcccgtctgatggcgacccagtcctggctggaagcgcgtctgaaaggcgagaagctgccc 14339 Query: 1021 aaaccagaaggcctgctgacacaaaacgaagaactgtgggaaccgctctacgcttgctac 1080 ||||| | ||||||||||| |||||||| | || |||||||| || ||||| |||||| Sbjct: 14338 aaaccggctggcctgctgacgcaaaacgagcagctctgggaacctctgtacgcctgctac 14279 Query: 1081 cagtcacttcaggcgtgtggcatgggtattatcgccaacggcgatctgctcgacaccctg 1140 ||||| | ||||| || |||||||| ||||||||||||||||| | |||||||| || Sbjct: 14278 cagtcgttacaggcctgcggcatgggcattatcgccaacggcgagttactcgacacgctc 14219 Query: 1141 cgccgcgtgaaatgtttcggcgtaccgctggtccgtattgatatccgtcaggagagcacg 1200 ||||||||||| |||||||||||||||||||| |||||||||||||| ||||| || || Sbjct: 14218 cgccgcgtgaagtgtttcggcgtaccgctggtgcgtattgatatccgccaggaaagtacc 14159 Query: 1201 cgtcataccgaagcgctgggcgagctgacccgctacctcggtatcggcgactacgaaagc 1260 || ||||| |||||||||||||| | ||||||||||||||||| ||||||||||||||| Sbjct: 14158 cgccatactgaagcgctgggcgaaattacccgctacctcggtattggcgactacgaaagc 14099 Query: 1261 tggtcagaggccgacaaacaggcgttcctgatccgcgaactgaactccaaacgtccgctt 1320 ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 14098 tggtcggaagccgacaagcaggccttcctgatccgcgaactgaactccaaacgtccgctg 14039 Query: 1321 ctgccgcgcaactggcaaccaagcgccgaaacgcgcgaagtgctcgatacctgccaggtg 1380 |||||||| |||||| | || ||| ||| || ||||||||||| || |||||| |||| Sbjct: 14038 ctgccgcgtaactgggagccgagcaacgatacccgcgaagtgcttgaaacctgcaaggtt 13979 Query: 1381 attgccgaagcaccgcaaggctccattgccgcctacgtgatctcgatggcgaaaacgccg 1440 ||||||||||| || |||| || || ||||||||||| || || ||||||||||||||| Sbjct: 13978 attgccgaagcgccaaaaggatcgatcgccgcctacgtaatttcaatggcgaaaacgccg 13919 Query: 1441 tccgacgtactggctgtccacctgctgctgaaagaagcgggtatcgggtttgcgatgccg 1500 || || || |||||||| || |||||||||||||| || |||||||| ||||| |||||| Sbjct: 13918 tctgatgtgctggctgtgcatctgctgctgaaagaggcaggtatcggctttgccatgccg 13859 Query: 1501 gttgctccgctgtttgaaaccctcgatgatctgaacaacgccaacgatgtcatgacccag 1560 || || ||||||||||||||||||||||| |||||||| ||| |||| || ||||||||| Sbjct: 13858 gtcgcgccgctgtttgaaaccctcgatgacctgaacaatgccgacgacgtgatgacccag 13799 Query: 1561 ctgctcaatattgactggtatcgtggcctgattcagggcaaacagatggtgatgattggc 1620 || | ||||| ||||||||||| || ||||||||||| || |||||||| ||||| ||| Sbjct: 13798 ttgttgaatatcgactggtatcgcggactgattcagggtaagcagatggtcatgatcggc 13739 Query: 1621 tattccgactcagcaaaagatgcgggagtgatggcagcttcctgggcgcaatatcaggca 1680 || |||||||| || ||||| || || || ||||| || || |||||||| |||||||| Sbjct: 13738 tactccgactcggcgaaagacgccggcgttatggccgcgtcatgggcgcagtatcaggcg 13679 Query: 1681 caggatgcattaatcaaaacctgcgaaaaagcgggtattgagctgacgttgttccacggt 1740 ||||| || | ||||||||||| |||||||| || || ||||| || | |||||||| Sbjct: 13678 caggacgccctgatcaaaacctgtgaaaaagccggcatcgagcttaccctcttccacggc 13619 Query: 1741 cgcggcggttccattggtcgcggcggcgcacctgctcatgcggcgctgctgtcacaaccg 1800 |||||||| || ||||| || |||||||| || || || ||||||||||| || |||||| Sbjct: 13618 cgcggcggatctattggccgtggcggcgcgccagcccacgcggcgctgctttcgcaaccg 13559 Query: 1801 ccaggaagcctgaaaggcggcctgcgcgtaaccgaacagggcgagatgatccgctttaaa 1860 ||||| || ||||||||||| |||||||| ||||| |||||||||||||||||||| ||| Sbjct: 13558 ccaggcagtctgaaaggcggtctgcgcgtgaccgagcagggcgagatgatccgcttcaaa 13499 Query: 1861 tatggtctgccagaaatcaccgtcagcagcctgtcgctttataccggggcgattctggaa 1920 || || ||||| ||| |||||||||||||||| ||||| || ||| | || ||||||||| Sbjct: 13498 tacggcctgccggaagtcaccgtcagcagcctctcgctctacaccagcgcaattctggaa 13439 Query: 1921 gccaacctgctgccaccgccggagccgaaagagagctggcgtcgcattatggatgaactg 1980 || ||||||||||| |||||||| |||||||| |||||||||| ||||||||||| || Sbjct: 13438 gcaaacctgctgccgccgccggaaccgaaagacagctggcgtcatattatggatgagctt 13379 Query: 1981 tcagtcatctcctgcgatgtctaccgcggctacgtacgtgaaaacaaagattttgtgcct 2040 || ||||||||||| || ||||||||||||||| || ||||| ||||| ||||| || Sbjct: 13378 tccgtcatctcctgtgaaacctaccgcggctacgtgcgcgaaaataaagactttgtaccg 13319 Query: 2041 tacttccgctccgctacgccggaacaagaactgggcaaactgccgttgggttcacgtccg 2100 |||||||||||||| |||||||| ||||| |||||||| ||||| | || ||||||||| Sbjct: 13318 tacttccgctccgcgacgccggagcaagagttgggcaaattgccgctcggctcacgtccg 13259 Query: 2101 gcgaaacgtcgcccaaccggcggcgtcgagtcactacgcgccattccgtggatcttcgcc 2160 ||||||||||| ||||| ||||||||||| || || ||||| |||||||||||||||||| Sbjct: 13258 gcgaaacgtcgtccaactggcggcgtcgaatcgctgcgcgcgattccgtggatcttcgcc 13199 Query: 2161 tggacgcaaaaccgtctgatgctccccgcctggctgggtgcaggtacggcgctgcaaaaa 2220 |||||||||||||| |||||||| || ||||||||||| || ||||| |||||||||||| Sbjct: 13198 tggacgcaaaaccgcctgatgctgccagcctggctgggcgcgggtactgcgctgcaaaaa 13139 Query: 2221 gtggtcgaagacggcaaacagagcgagctggaggctatgtgccgcgattggccattcttc 2280 ||||| |||||||| ||||| ||||| ||||| || ||||||||||| ||||| |||||| Sbjct: 13138 gtggtggaagacggtaaacaaagcgaactggaagccatgtgccgcgactggccgttcttc 13079 Query: 2281 tcgacgcgtctcggcatgctggagatggtcttcgccaaagcagacctgtggctggcggaa 2340 || |||||||| || |||||||| ||||| ||| | ||||| |||||||||||||| || Sbjct: 13078 tccacgcgtcttgggatgctggaaatggtgttctcgaaagccgacctgtggctggccgac 13019 Query: 2341 tactatgaccaacgcctggtagacaaagcactgtggccgttaggtaaagagttacgcaac 2400 || || || || |||||||| | ||| | || |||||| | || |||||| |||| || Sbjct: 13018 tattacgatcagcgcctggtggcgaaaacgctttggccgctgggcaaagagctacgagac 12959 Query: 2401 ctgcaagaagaagacatcaaagtggtgctggcgattgccaacgattcccatctgatggcc 2460 || | ||||||||||| ||||||||||||||||||||||||||||| || ||||||||| Sbjct: 12958 ctactggaagaagacattaaagtggtgctggcgattgccaacgattcgcacctgatggcc 12899 Query: 2461 gatctgccgtggattgcagagtctattcagctacggaatatttacaccgacccgctgaac 2520 || | ||||||||||| ||||| |||||| || | || |||| ||||| || | ||| Sbjct: 12898 gacttaccgtggattgcggagtccattcagttaagaaacgtttataccgatccattaaac 12839 Query: 2521 gtattgcaggccgagttgctg 2541 || ||||||||||| |||||| Sbjct: 12838 gtgttgcaggccgaattgctg 12818 Score = 56.0 bits (28), Expect = 4e-07 Identities = 61/72 (84%) Strand = Plus / Minus Query: 2581 gatcctcgcgtcgaacaagcgttaatggtcactattgccgggattgcggcaggtatgcgt 2640 ||||||||||||||||| ||||| |||||||| ||||| || | || || |||||||| Sbjct: 12778 gatcctcgcgtcgaacaggcgttgatggtcacgattgcgggcgtcgctgccggtatgcgc 12719 Query: 2641 aataccggctaa 2652 || ||||||||| Sbjct: 12718 aacaccggctaa 12707 >embl|AE006090|AE006090 Pasteurella multocida subsp. multocida str. Pm70 section 57 of 204 of the complete genome. Length = 9961 Score = 52.0 bits (26), Expect = 7e-06 Identities = 62/74 (83%) Strand = Plus / Minus Query: 1600 aaacagatggtgatgattggctattccgactcagcaaaagatgcgggagtgatggcagct 1659 ||||| |||||||||||||| ||||| || || || ||||||||||| ||||||| || Sbjct: 5244 aaacaaatggtgatgattggttattcggattctgccaaagatgcggggatgatggcggcc 5185 Query: 1660 tcctgggcgcaata 1673 || ||||| ||||| Sbjct: 5184 tcttgggcacaata 5171 Score = 42.1 bits (21), Expect = 0.007 Identities = 45/53 (84%) Strand = Plus / Minus Query: 2593 gaacaagcgttaatggtcactattgccgggattgcggcaggtatgcgtaatac 2645 ||||||||||||||| |||| ||| |||| | || || |||||||||||||| Sbjct: 4260 gaacaagcgttaatgatcaccattaccggtgtcgcagccggtatgcgtaatac 4208 Score = 32.2 bits (16), Expect = 6.5 Identities = 34/40 (85%) Strand = Plus / Minus Query: 538 cagttgatcgcccagtcatggcataccgatgaaatccgta 577 ||||||||||| ||| | ||||||||| | ||||| |||| Sbjct: 6303 cagttgatcgcacaggcttggcataccaacgaaattcgta 6264 >AE012116 AE008922 |AE012116| Xanthomonas campestris pv. campestris str. ATCC 33913, section 24 of 460 of the complete genome. Length = 13074 Score = 44.1 bits (22), Expect = 0.002 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1126 ctgctcgacaccctgcgccgcg 1147 |||||||||||||||||||||| Sbjct: 2772 ctgctcgacaccctgcgccgcg 2751 >AE008808 AE006468 |AE008808| Salmonella typhimurium LT2, section 112 of 220 of the complete genome. Length = 22929 Score = 38.2 bits (19), Expect = 0.11 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2177 tgatgctccccgcctggct 2195 ||||||||||||||||||| Sbjct: 14358 tgatgctccccgcctggct 14376 >AE008881 AE006468 |AE008881| Salmonella typhimurium LT2, section 185 of 220 of the complete genome. Length = 21570 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%) Strand = Plus / Plus Query: 891 tgaactgctggcgctggt 908 |||||||||||||||||| Sbjct: 12183 tgaactgctggcgctggt 12200 >AE008724 AE006468 |AE008724| Salmonella typhimurium LT2, section 32 of 220 of the complete genome. Length = 26720 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%) Strand = Plus / Minus Query: 2539 ctgcaccgctcccgccag 2556 |||||||||||||||||| Sbjct: 520 ctgcaccgctcccgccag 503 >AE012314 AE008922 |AE012314| Xanthomonas campestris pv. campestris str. ATCC 33913, section 222 of 460 of the complete genome. Length = 11236 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%) Strand = Plus / Plus Query: 376 gtggaatcgctgtcgctg 393 |||||||||||||||||| Sbjct: 8599 gtggaatcgctgtcgctg 8616 >AE012305 AE008922 |AE012305| Xanthomonas campestris pv. campestris str. ATCC 33913, section 213 of 460 of the complete genome. Length = 12172 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%) Strand = Plus / Plus Query: 340 cagccggaactgagcgaa 357 |||||||||||||||||| Sbjct: 1301 cagccggaactgagcgaa 1318 >AE012294 AE008922 |AE012294| Xanthomonas campestris pv. campestris str. ATCC 33913, section 202 of 460 of the complete genome. Length = 10621 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1209 cgaagcgctgggcgagct 1226 |||||||||||||||||| Sbjct: 5038 cgaagcgctgggcgagct 5055 >AE012171 AE008922 |AE012171| Xanthomonas campestris pv. campestris str. ATCC 33913, section 79 of 460 of the complete genome. Length = 13045 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1647 agtgatggcagcttcctg 1664 |||||||||||||||||| Sbjct: 11095 agtgatggcagcttcctg 11112 >embl|AE006199|AE006199 Pasteurella multocida subsp. multocida str. Pm70 section 166 of 204 of the complete genome. Length = 10462 Score = 34.2 bits (17), Expect = 1.6 Identities = 17/17 (100%) Strand = Plus / Plus Query: 167 tgctcaccaccttacaa 183 ||||||||||||||||| Sbjct: 3048 tgctcaccaccttacaa 3064 >AE008908 AE006468 |AE008908| Salmonella typhimurium LT2, section 212 of 220 of the complete genome. Length = 20456 Score = 34.2 bits (17), Expect = 1.6 Identities = 17/17 (100%) Strand = Plus / Plus Query: 749 gcggcgaccgcgacggc 765 ||||||||||||||||| Sbjct: 599 gcggcgaccgcgacggc 615 >AE008900 AE006468 |AE008900| Salmonella typhimurium LT2, section 204 of 220 of the complete genome. Length = 21498 Score = 34.2 bits (17), Expect = 1.6 Identities = 17/17 (100%) Strand = Plus / Minus Query: 1113 cgccaacggcgatctgc 1129 ||||||||||||||||| Sbjct: 6392 cgccaacggcgatctgc 6376 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 2212 ctgcaaaaagtggtcg 2227 |||||||||||||||| Sbjct: 15709 ctgcaaaaagtggtcg 15724 >AE008877 AE006468 |AE008877| Salmonella typhimurium LT2, section 181 of 220 of the complete genome. Length = 22492 Score = 34.2 bits (17), Expect = 1.6 Identities = 17/17 (100%) Strand = Plus / Minus Query: 2558 cagaaaaagaaggccag 2574 ||||||||||||||||| Sbjct: 1972 cagaaaaagaaggccag 1956 >AE008794 AE006468 |AE008794| Salmonella typhimurium LT2, section 98 of 220 of the complete genome. Length = 26591 Score = 34.2 bits (17), Expect = 1.6 Identities = 17/17 (100%) Strand = Plus / Plus Query: 2608 gtcactattgccgggat 2624 ||||||||||||||||| Sbjct: 24108 gtcactattgccgggat 24124 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 525 gcgtcgcctgcgccag 540 |||||||||||||||| Sbjct: 12958 gcgtcgcctgcgccag 12973 >AE012473 AE008922 |AE012473| Xanthomonas campestris pv. campestris str. ATCC 33913, section 381 of 460 of the complete genome. Length = 11134 Score = 34.2 bits (17), Expect = 1.6 Identities = 17/17 (100%) Strand = Plus / Minus Query: 2423 tggtgctggcgattgcc 2439 ||||||||||||||||| Sbjct: 9197 tggtgctggcgattgcc 9181 >embl|AE006209|AE006209 Pasteurella multocida subsp. multocida str. Pm70 section 176 of 204 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 408 ggctcacccaaccgaaatta 427 ||||| |||||||||||||| Sbjct: 434 ggctcgcccaaccgaaatta 453 >embl|AE006109|AE006109 Pasteurella multocida subsp. multocida str. Pm70 section 76 of 204 of the complete genome. Length = 13603 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 6 cgaacaatattccgca 21 |||||||||||||||| Sbjct: 10291 cgaacaatattccgca 10276 >AE008914 AE006468 |AE008914| Salmonella typhimurium LT2, section 218 of 220 of the complete genome. Length = 22694 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 890 ctgaactgctggcgct 905 |||||||||||||||| Sbjct: 4319 ctgaactgctggcgct 4304 >AE008872 AE006468 |AE008872| Salmonella typhimurium LT2, section 176 of 220 of the complete genome. Length = 20456 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Minus Query: 987 gctggaagcgcgcctgaaag 1006 |||||||||||| ||||||| Sbjct: 13370 gctggaagcgcggctgaaag 13351 >AE008867 AE006468 |AE008867| Salmonella typhimurium LT2, section 171 of 220 of the complete genome. Length = 21910 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 335 aaaaccagccggaact 350 |||||||||||||||| Sbjct: 19864 aaaaccagccggaact 19879 >AE008859 AE006468 |AE008859| Salmonella typhimurium LT2, section 163 of 220 of the complete genome. Length = 23069 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1897 ctttataccggggcga 1912 |||||||||||||||| Sbjct: 22 ctttataccggggcga 7 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 670 ctgaacgaacaactggaaga 689 ||||||||||| |||||||| Sbjct: 13783 ctgaacgaacatctggaaga 13802 >AE008858 AE006468 |AE008858| Salmonella typhimurium LT2, section 162 of 220 of the complete genome. Length = 20646 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1897 ctttataccggggcga 1912 |||||||||||||||| Sbjct: 20608 ctttataccggggcga 20593 >AE008853 AE006468 |AE008853| Salmonella typhimurium LT2, section 157 of 220 of the complete genome. Length = 21918 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 2422 gtggtgctggcgattg 2437 |||||||||||||||| Sbjct: 6563 gtggtgctggcgattg 6548 >AE008835 AE006468 |AE008835| Salmonella typhimurium LT2, section 139 of 220 of the complete genome. Length = 21791 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 872 cgatggttgaagcgac 887 |||||||||||||||| Sbjct: 14913 cgatggttgaagcgac 14898 >AE008809 AE006468 |AE008809| Salmonella typhimurium LT2, section 113 of 220 of the complete genome. Length = 22803 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1462 ctgctgctgaaagaag 1477 |||||||||||||||| Sbjct: 16128 ctgctgctgaaagaag 16143 >AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section 111 of 220 of the complete genome. Length = 20167 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 961 tctcgcctgatggcga 976 |||||||||||||||| Sbjct: 11970 tctcgcctgatggcga 11955 >AE008791 AE006468 |AE008791| Salmonella typhimurium LT2, section 95 of 220 of the complete genome. Length = 22779 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 907 gttggcgaagaaggtg 922 |||||||||||||||| Sbjct: 22545 gttggcgaagaaggtg 22560 >AE008773 AE006468 |AE008773| Salmonella typhimurium LT2, section 77 of 220 of the complete genome. Length = 20449 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1373 gccaggtgattgccga 1388 |||||||||||||||| Sbjct: 8090 gccaggtgattgccga 8105 >AE008766 AE006468 |AE008766| Salmonella typhimurium LT2, section 70 of 220 of the complete genome. Length = 27275 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1425 gatggcgaaaacgccg 1440 |||||||||||||||| Sbjct: 2678 gatggcgaaaacgccg 2693 >AE008755 AE006468 |AE008755| Salmonella typhimurium LT2, section 59 of 220 of the complete genome. Length = 20029 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 2462 atctgccgtggattgc 2477 |||||||||||||||| Sbjct: 3211 atctgccgtggattgc 3196 >AE008737 AE006468 AE008738-AE008739 |AE008737| Salmonella typhimurium LT2, section 45 of 220 of the complete genome. Length = 65219 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1430 cgaaaacgccgtccga 1445 |||||||||||||||| Sbjct: 12063 cgaaaacgccgtccga 12048 >AE008718 AE006468 |AE008718| Salmonella typhimurium LT2, section 26 of 220 of the complete genome. Length = 20938 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1469 tgaaagaagcgggtat 1484 |||||||||||||||| Sbjct: 11891 tgaaagaagcgggtat 11906 >AE008717 AE006468 |AE008717| Salmonella typhimurium LT2, section 25 of 220 of the complete genome. Length = 20347 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 532 ctgcgccagttgatcg 547 |||||||||||||||| Sbjct: 4293 ctgcgccagttgatcg 4278 >AE008702 AE006468 |AE008702| Salmonella typhimurium LT2, section 10 of 220 of the complete genome. Length = 21072 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 471 tttaaaacagctcgat 486 |||||||||||||||| Sbjct: 6635 tttaaaacagctcgat 6650 >AE008701 AE006468 |AE008701| Salmonella typhimurium LT2, section 9 of 220 of the complete genome. Length = 22692 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 774 cgtcactgccgatatc 789 |||||||||||||||| Sbjct: 5993 cgtcactgccgatatc 5978 >AE012531 AE008922 |AE012531| Xanthomonas campestris pv. campestris str. ATCC 33913, section 439 of 460 of the complete genome. Length = 11870 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 2116 accggcggcgtcgagt 2131 |||||||||||||||| Sbjct: 1629 accggcggcgtcgagt 1644 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 2424 ggtgctggcgattgcc 2439 |||||||||||||||| Sbjct: 10339 ggtgctggcgattgcc 10324 >AE012482 AE008922 |AE012482| Xanthomonas campestris pv. campestris str. ATCC 33913, section 390 of 460 of the complete genome. Length = 10246 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 373 gcagtggaatcgctgt 388 |||||||||||||||| Sbjct: 5683 gcagtggaatcgctgt 5698 >AE012481 AE008922 |AE012481| Xanthomonas campestris pv. campestris str. ATCC 33913, section 389 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1375 caggtgattgccgaag 1390 |||||||||||||||| Sbjct: 555 caggtgattgccgaag 570 >AE012480 AE008922 |AE012480| Xanthomonas campestris pv. campestris str. ATCC 33913, section 388 of 460 of the complete genome. Length = 11838 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1457 tccacctgctgctgaa 1472 |||||||||||||||| Sbjct: 4824 tccacctgctgctgaa 4809 >AE012476 AE008922 |AE012476| Xanthomonas campestris pv. campestris str. ATCC 33913, section 384 of 460 of the complete genome. Length = 10696 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 904 ctggttggcgaagaag 919 |||||||||||||||| Sbjct: 1379 ctggttggcgaagaag 1394 >AE012456 AE008922 |AE012456| Xanthomonas campestris pv. campestris str. ATCC 33913, section 364 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 2425 gtgctggcgattgcca 2440 |||||||||||||||| Sbjct: 4495 gtgctggcgattgcca 4510 >AE012392 AE008922 |AE012392| Xanthomonas campestris pv. campestris str. ATCC 33913, section 300 of 460 of the complete genome. Length = 10825 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 237 gaacctggccaacaccgccg 256 |||||||||||| ||||||| Sbjct: 4985 gaacctggccaagaccgccg 5004 >AE012391 AE008922 |AE012391| Xanthomonas campestris pv. campestris str. ATCC 33913, section 299 of 460 of the complete genome. Length = 11677 Score = 32.2 bits (16), Expect = 6.5 Identities = 22/24 (91%) Strand = Plus / Minus Query: 2524 ttgcaggccgagttgctgcaccgc 2547 |||||| ||||| ||||||||||| Sbjct: 340 ttgcagaccgagctgctgcaccgc 317 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1742 gcggcggttccattgg 1757 |||||||||||||||| Sbjct: 4727 gcggcggttccattgg 4712 >AE012387 AE008922 |AE012387| Xanthomonas campestris pv. campestris str. ATCC 33913, section 295 of 460 of the complete genome. Length = 9939 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 1917 ggaagccaacctgctgccac 1936 ||||||| |||||||||||| Sbjct: 5853 ggaagccgacctgctgccac 5872 >AE012372 AE008922 |AE012372| Xanthomonas campestris pv. campestris str. ATCC 33913, section 280 of 460 of the complete genome. Length = 10591 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 2420 aagtggtgctggcgat 2435 |||||||||||||||| Sbjct: 10194 aagtggtgctggcgat 10179 >AE012358 AE008922 |AE012358| Xanthomonas campestris pv. campestris str. ATCC 33913, section 266 of 460 of the complete genome. Length = 11304 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1321 ctgccgcgcaactggc 1336 |||||||||||||||| Sbjct: 2624 ctgccgcgcaactggc 2609 >AE012346 AE008922 |AE012346| Xanthomonas campestris pv. campestris str. ATCC 33913, section 254 of 460 of the complete genome. Length = 10162 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 752 gcgaccgcgacggcaacccg 771 |||||||| ||||||||||| Sbjct: 7911 gcgaccgcaacggcaacccg 7930 >AE012343 AE008922 |AE012343| Xanthomonas campestris pv. campestris str. ATCC 33913, section 251 of 460 of the complete genome. Length = 12314 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 138 cgctggcaatgatgct 153 |||||||||||||||| Sbjct: 5636 cgctggcaatgatgct 5621 >AE012326 AE008922 |AE012326| Xanthomonas campestris pv. campestris str. ATCC 33913, section 234 of 460 of the complete genome. Length = 10551 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Minus Query: 1345 gccgaaacgcgcgaagtgct 1364 ||||||| |||||||||||| Sbjct: 7995 gccgaaatgcgcgaagtgct 7976 >AE012322 AE008922 |AE012322| Xanthomonas campestris pv. campestris str. ATCC 33913, section 230 of 460 of the complete genome. Length = 10444 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Minus Query: 1650 gatggcagcttcctgggcgc 1669 ||||||||||||||| |||| Sbjct: 6196 gatggcagcttcctgcgcgc 6177 >AE012310 AE008922 |AE012310| Xanthomonas campestris pv. campestris str. ATCC 33913, section 218 of 460 of the complete genome. Length = 10787 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1464 gctgctgaaagaagcg 1479 |||||||||||||||| Sbjct: 9807 gctgctgaaagaagcg 9792 >AE012296 AE008922 |AE012296| Xanthomonas campestris pv. campestris str. ATCC 33913, section 204 of 460 of the complete genome. Length = 11064 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1762 ggcggcgcacctgctc 1777 |||||||||||||||| Sbjct: 9790 ggcggcgcacctgctc 9805 >AE012289 AE008922 |AE012289| Xanthomonas campestris pv. campestris str. ATCC 33913, section 197 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 532 ctgcgccagttgatcg 547 |||||||||||||||| Sbjct: 4382 ctgcgccagttgatcg 4367 >AE012284 AE008922 |AE012284| Xanthomonas campestris pv. campestris str. ATCC 33913, section 192 of 460 of the complete genome. Length = 10204 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1215 gctgggcgagctgacc 1230 |||||||||||||||| Sbjct: 6693 gctgggcgagctgacc 6678 >AE012268 AE008922 |AE012268| Xanthomonas campestris pv. campestris str. ATCC 33913, section 176 of 460 of the complete genome. Length = 11409 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1920 agccaacctgctgcca 1935 |||||||||||||||| Sbjct: 7837 agccaacctgctgcca 7822 >AE012229 AE008922 |AE012229| Xanthomonas campestris pv. campestris str. ATCC 33913, section 137 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1156 ttcggcgtaccgctgg 1171 |||||||||||||||| Sbjct: 5072 ttcggcgtaccgctgg 5087 >AE012217 AE008922 |AE012217| Xanthomonas campestris pv. campestris str. ATCC 33913, section 125 of 460 of the complete genome. Length = 11498 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 528 tcgcctgcgccagttgatcg 547 ||||||||||||| |||||| Sbjct: 11318 tcgcctgcgccagctgatcg 11337 >AE012181 AE008922 |AE012181| Xanthomonas campestris pv. campestris str. ATCC 33913, section 89 of 460 of the complete genome. Length = 10179 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1217 tgggcgagctgacccg 1232 |||||||||||||||| Sbjct: 5108 tgggcgagctgacccg 5093 >AE012180 AE008922 |AE012180| Xanthomonas campestris pv. campestris str. ATCC 33913, section 88 of 460 of the complete genome. Length = 10929 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 195 cgacgagctgctgccc 210 |||||||||||||||| Sbjct: 5333 cgacgagctgctgccc 5348 >AE012177 AE008922 |AE012177| Xanthomonas campestris pv. campestris str. ATCC 33913, section 85 of 460 of the complete genome. Length = 10568 Score = 32.2 bits (16), Expect = 6.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 903 gctggttggcgaagaaggtg 922 ||||||||||||| |||||| Sbjct: 5165 gctggttggcgaacaaggtg 5184 >AE012157 AE008922 |AE012157| Xanthomonas campestris pv. campestris str. ATCC 33913, section 65 of 460 of the complete genome. Length = 12504 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 2503 tacaccgacccgctga 2518 |||||||||||||||| Sbjct: 3192 tacaccgacccgctga 3207 >AE012144 AE008922 |AE012144| Xanthomonas campestris pv. campestris str. ATCC 33913, section 52 of 460 of the complete genome. Length = 10816 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1122 cgatctgctcgacacc 1137 |||||||||||||||| Sbjct: 6814 cgatctgctcgacacc 6829 >AE012112 AE008922 |AE012112| Xanthomonas campestris pv. campestris str. ATCC 33913, section 20 of 460 of the complete genome. Length = 12215 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1004 aaggcgaagaactgcc 1019 |||||||||||||||| Sbjct: 5340 aaggcgaagaactgcc 5355 >AE012104 AE008922 |AE012104| Xanthomonas campestris pv. campestris str. ATCC 33913, section 12 of 460 of the complete genome. Length = 12966 Score = 32.2 bits (16), Expect = 6.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 2066 aagaactgggcaaact 2081 |||||||||||||||| Sbjct: 12159 aagaactgggcaaact 12174 Database: 3g Posted date: Oct 31, 2007 1:21 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 424,343 Number of extensions: 27453 Number of successful extensions: 76 Number of sequences better than 10.0: 65 Number of HSP's gapped: 73 Number of HSP's successfully gapped: 73 Length of query: 2652 Length of database: 12,243,887 Length adjustment: 18 Effective length of query: 2634 Effective length of database: 12,227,975 Effective search space: 32208486150 Effective search space used: 32208486150 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 16 (32.2 bits) S2: 16 (32.2 bits)