BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= M13747 M13747.1 E.coli purM gene encoding 5'-phosphoribosyl-5-aminoimidazole synthetase, and purN gene, complete cds. (639 letters) Database: all 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008812 AE006468 |AE008812| Salmonella typhimurium LT2, section... 238 1e-62 >AE008812 AE006468 |AE008812| Salmonella typhimurium LT2, section 116 of 220 of the complete genome. Length = 23865 Score = 238 bits (120), Expect = 1e-62 Identities = 315/380 (82%) Strand = Plus / Plus Query: 238 cccgatgtggtcgtgctggctggttttatgcgcattctcagcccggcgtttgtctcccac 297 |||||||||||||||||||| ||||||||||| ||||| || ||| ||||||| | || Sbjct: 17336 cccgatgtggtcgtgctggccggttttatgcgtattctgagtccgatgtttgtcgcgcat 17395 Query: 298 tatgccgggcgtttgctgaacattcacccttctctgctgccgaaatatcccggattacac 357 || ||||||| ||||||||||||||||||| ||||| || |||||||| || || || Sbjct: 17396 tactacgggcgtctgctgaacattcacccttccctgctaccaaaatatccggggttgcat 17455 Query: 358 acccatcgtcaggcgctggaaaatggcgatgaagagcacggtacatcggtgcatttcgtc 417 |||||||| |||||||||||||| |||||||| ||||||||||| ||||| |||||||| Sbjct: 17456 acccatcgccaggcgctggaaaacggcgatgaggagcacggtacctcggtacatttcgtg 17515 Query: 418 accgatgaactggacggtggcccggttattttacaggcgaaagtcccggtatttgctggt 477 || || ||||| ||||| |||||||| ||| | |||||||| || ||||| ||||| Sbjct: 17516 acagacgaactcgacggcggcccggtcattctccaggcgaaggtgccggtttttgccaac 17575 Query: 478 gattcggaagatgacatcaccgcccgcgtgcaaacccaggaacacgccatttatccactg 537 || |||||||| |||||||| ||||| || || |||||||| || |||||||| ||| Sbjct: 17576 gacagcgaagatgatatcaccgcacgcgtacagactcaggaacatgcgatttatccgctg 17635 Query: 538 gtgattagctggtttgccgatggtcgtctgaaaatgcacgaaaacgccgcgtggctggat 597 ||||||||||||||||| | || ||||| || |||| ||| |||||||| |||||||| Sbjct: 17636 gtgattagctggtttgcgcaggggcgtctaaagatgcgcgataacgccgcctggctggac 17695 Query: 598 ggtcaacgtctgccgccgca 617 || | |||||||||||||| Sbjct: 17696 gggcgtcgtctgccgccgca 17715 Score = 155 bits (78), Expect = 2e-37 Identities = 123/138 (89%) Strand = Plus / Plus Query: 1 atgaatattgtggtgcttatttccggcaacggaagtaatttacaggcaattattgacgcc 60 ||||||||||||||||| ||||||||||| ||||| ||||||||||| ||||| || ||| Sbjct: 17099 atgaatattgtggtgctgatttccggcaatggaagcaatttacaggcgattatcgatgcc 17158 Query: 61 tgtaaaaccaacaaaattaaaggcaccgtacgggcagttttcagcaataaggccgacgcg 120 || || | || ||||||||||||||| | ||||||| ||||||||||||||||||||| Sbjct: 17159 tgcgaagcgaagaaaattaaaggcaccctcagggcagtattcagcaataaggccgacgcg 17218 Query: 121 ttcggccttgaacgcgcc 138 |||||||||||||||||| Sbjct: 17219 ttcggccttgaacgcgcc 17236 Database: all Posted date: Nov 9, 2008 11:44 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 106,402 Number of extensions: 6462 Number of successful extensions: 53 Number of sequences better than 1.0e-03: 1 Number of HSP's gapped: 52 Number of HSP's successfully gapped: 3 Length of query: 639 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 622 Effective length of database: 12,228,859 Effective search space: 7606350298 Effective search space used: 7606350298 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 22 (44.1 bits)