BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= M13747 M13747.1 E.coli purM gene encoding 5'-phosphoribosyl-5-aminoimidazole synthetase, and purN gene, complete cds. (639 letters) Database: all 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008812 AE006468 |AE008812| Salmonella typhimurium LT2, section... 238 1e-62 AE008885 AE006468 |AE008885| Salmonella typhimurium LT2, section... 42 0.002 embl|AE006107|AE006107 Pasteurella multocida subsp. multocida st... 34 0.39 AE012436 AE008922 |AE012436| Xanthomonas campestris pv. campestr... 34 0.39 AE012173 AE008922 |AE012173| Xanthomonas campestris pv. campestr... 34 0.39 embl|AE006207|AE006207 Pasteurella multocida subsp. multocida st... 32 1.5 AE012516 AE008922 |AE012516| Xanthomonas campestris pv. campestr... 32 1.5 AE008829 AE006468 |AE008829| Salmonella typhimurium LT2, section... 32 1.5 AE008761 AE006468 |AE008761| Salmonella typhimurium LT2, section... 32 1.5 embl|AE006225|AE006225 Pasteurella multocida subsp. multocida st... 30 6.0 embl|AE006204|AE006204 Pasteurella multocida subsp. multocida st... 30 6.0 embl|AE006035|AE006035 Pasteurella multocida subsp. multocida st... 30 6.0 AE012522 AE008922 |AE012522| Xanthomonas campestris pv. campestr... 30 6.0 AE012520 AE008922 |AE012520| Xanthomonas campestris pv. campestr... 30 6.0 AE012469 AE008922 |AE012469| Xanthomonas campestris pv. campestr... 30 6.0 AE012413 AE008922 |AE012413| Xanthomonas campestris pv. campestr... 30 6.0 AE012390 AE008922 |AE012390| Xanthomonas campestris pv. campestr... 30 6.0 AE012384 AE008922 |AE012384| Xanthomonas campestris pv. campestr... 30 6.0 AE012353 AE008922 |AE012353| Xanthomonas campestris pv. campestr... 30 6.0 AE012256 AE008922 |AE012256| Xanthomonas campestris pv. campestr... 30 6.0 AE012233 AE008922 |AE012233| Xanthomonas campestris pv. campestr... 30 6.0 AE012213 AE008922 |AE012213| Xanthomonas campestris pv. campestr... 30 6.0 AE012175 AE008922 |AE012175| Xanthomonas campestris pv. campestr... 30 6.0 AE012157 AE008922 |AE012157| Xanthomonas campestris pv. campestr... 30 6.0 AE012138 AE008922 |AE012138| Xanthomonas campestris pv. campestr... 30 6.0 AE012125 AE008922 |AE012125| Xanthomonas campestris pv. campestr... 30 6.0 AE008904 AE006468 |AE008904| Salmonella typhimurium LT2, section... 30 6.0 AE008897 AE006468 |AE008897| Salmonella typhimurium LT2, section... 30 6.0 AE008875 AE006468 |AE008875| Salmonella typhimurium LT2, section... 30 6.0 AE008869 AE006468 |AE008869| Salmonella typhimurium LT2, section... 30 6.0 AE008866 AE006468 |AE008866| Salmonella typhimurium LT2, section... 30 6.0 AE008864 AE006468 |AE008864| Salmonella typhimurium LT2, section... 30 6.0 AE008860 AE006468 |AE008860| Salmonella typhimurium LT2, section... 30 6.0 AE008839 AE006468 |AE008839| Salmonella typhimurium LT2, section... 30 6.0 AE008823 AE006468 |AE008823| Salmonella typhimurium LT2, section... 30 6.0 AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section... 30 6.0 AE008806 AE006468 |AE008806| Salmonella typhimurium LT2, section... 30 6.0 AE008802 AE006468 |AE008802| Salmonella typhimurium LT2, section... 30 6.0 AE008787 AE006468 |AE008787| Salmonella typhimurium LT2, section... 30 6.0 AE008783 AE006468 |AE008783| Salmonella typhimurium LT2, section... 30 6.0 AE008775 AE006468 |AE008775| Salmonella typhimurium LT2, section... 30 6.0 AE008769 AE006468 |AE008769| Salmonella typhimurium LT2, section... 30 6.0 AE008735 AE006468 |AE008735| Salmonella typhimurium LT2, section... 30 6.0 AE008723 AE006468 |AE008723| Salmonella typhimurium LT2, section... 30 6.0 AE008715 AE006468 |AE008715| Salmonella typhimurium LT2, section... 30 6.0 AE008711 AE006468 |AE008711| Salmonella typhimurium LT2, section... 30 6.0 AE008697 AE006468 |AE008697| Salmonella typhimurium LT2, section... 30 6.0 >AE008812 AE006468 |AE008812| Salmonella typhimurium LT2, section 116 of 220 of the complete genome. Length = 23865 Score = 238 bits (120), Expect = 1e-62 Identities = 315/380 (82%) Strand = Plus / Plus Query: 238 cccgatgtggtcgtgctggctggttttatgcgcattctcagcccggcgtttgtctcccac 297 |||||||||||||||||||| ||||||||||| ||||| || ||| ||||||| | || Sbjct: 17336 cccgatgtggtcgtgctggccggttttatgcgtattctgagtccgatgtttgtcgcgcat 17395 Query: 298 tatgccgggcgtttgctgaacattcacccttctctgctgccgaaatatcccggattacac 357 || ||||||| ||||||||||||||||||| ||||| || |||||||| || || || Sbjct: 17396 tactacgggcgtctgctgaacattcacccttccctgctaccaaaatatccggggttgcat 17455 Query: 358 acccatcgtcaggcgctggaaaatggcgatgaagagcacggtacatcggtgcatttcgtc 417 |||||||| |||||||||||||| |||||||| ||||||||||| ||||| |||||||| Sbjct: 17456 acccatcgccaggcgctggaaaacggcgatgaggagcacggtacctcggtacatttcgtg 17515 Query: 418 accgatgaactggacggtggcccggttattttacaggcgaaagtcccggtatttgctggt 477 || || ||||| ||||| |||||||| ||| | |||||||| || ||||| ||||| Sbjct: 17516 acagacgaactcgacggcggcccggtcattctccaggcgaaggtgccggtttttgccaac 17575 Query: 478 gattcggaagatgacatcaccgcccgcgtgcaaacccaggaacacgccatttatccactg 537 || |||||||| |||||||| ||||| || || |||||||| || |||||||| ||| Sbjct: 17576 gacagcgaagatgatatcaccgcacgcgtacagactcaggaacatgcgatttatccgctg 17635 Query: 538 gtgattagctggtttgccgatggtcgtctgaaaatgcacgaaaacgccgcgtggctggat 597 ||||||||||||||||| | || ||||| || |||| ||| |||||||| |||||||| Sbjct: 17636 gtgattagctggtttgcgcaggggcgtctaaagatgcgcgataacgccgcctggctggac 17695 Query: 598 ggtcaacgtctgccgccgca 617 || | |||||||||||||| Sbjct: 17696 gggcgtcgtctgccgccgca 17715 Score = 155 bits (78), Expect = 2e-37 Identities = 123/138 (89%) Strand = Plus / Plus Query: 1 atgaatattgtggtgcttatttccggcaacggaagtaatttacaggcaattattgacgcc 60 ||||||||||||||||| ||||||||||| ||||| ||||||||||| ||||| || ||| Sbjct: 17099 atgaatattgtggtgctgatttccggcaatggaagcaatttacaggcgattatcgatgcc 17158 Query: 61 tgtaaaaccaacaaaattaaaggcaccgtacgggcagttttcagcaataaggccgacgcg 120 || || | || ||||||||||||||| | ||||||| ||||||||||||||||||||| Sbjct: 17159 tgcgaagcgaagaaaattaaaggcaccctcagggcagtattcagcaataaggccgacgcg 17218 Query: 121 ttcggccttgaacgcgcc 138 |||||||||||||||||| Sbjct: 17219 ttcggccttgaacgcgcc 17236 >AE008885 AE006468 |AE008885| Salmonella typhimurium LT2, section 189 of 220 of the complete genome. Length = 20366 Score = 42.1 bits (21), Expect = 0.002 Identities = 21/21 (100%) Strand = Plus / Plus Query: 109 aaggccgacgcgttcggcctt 129 ||||||||||||||||||||| Sbjct: 7941 aaggccgacgcgttcggcctt 7961 >embl|AE006107|AE006107 Pasteurella multocida subsp. multocida str. Pm70 section 74 of 204 of the complete genome. Length = 12832 Score = 34.2 bits (17), Expect = 0.39 Identities = 23/25 (92%) Strand = Plus / Plus Query: 51 tattgacgcctgtaaaaccaacaaa 75 ||||||||||||||| | ||||||| Sbjct: 8469 tattgacgcctgtaatagcaacaaa 8493 >AE012436 AE008922 |AE012436| Xanthomonas campestris pv. campestris str. ATCC 33913, section 344 of 460 of the complete genome. Length = 11689 Score = 34.2 bits (17), Expect = 0.39 Identities = 17/17 (100%) Strand = Plus / Plus Query: 133 cgcgcccgccaggcggg 149 ||||||||||||||||| Sbjct: 8782 cgcgcccgccaggcggg 8798 >AE012173 AE008922 |AE012173| Xanthomonas campestris pv. campestris str. ATCC 33913, section 81 of 460 of the complete genome. Length = 10808 Score = 34.2 bits (17), Expect = 0.39 Identities = 17/17 (100%) Strand = Plus / Plus Query: 583 gccgcgtggctggatgg 599 ||||||||||||||||| Sbjct: 556 gccgcgtggctggatgg 572 >embl|AE006207|AE006207 Pasteurella multocida subsp. multocida str. Pm70 section 174 of 204 of the complete genome. Length = 10499 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 544 agctggtttgccgatg 559 |||||||||||||||| Sbjct: 7201 agctggtttgccgatg 7216 >AE012516 AE008922 |AE012516| Xanthomonas campestris pv. campestris str. ATCC 33913, section 424 of 460 of the complete genome. Length = 10866 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 130 gaacgcgcccgccagg 145 |||||||||||||||| Sbjct: 6023 gaacgcgcccgccagg 6008 >AE008829 AE006468 |AE008829| Salmonella typhimurium LT2, section 133 of 220 of the complete genome. Length = 20371 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 363 tcgtcaggcgctggaa 378 |||||||||||||||| Sbjct: 12634 tcgtcaggcgctggaa 12649 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 619 ggctacgctgccgac 633 ||||||||||||||| Sbjct: 10356 ggctacgctgccgac 10342 >AE008761 AE006468 |AE008761| Salmonella typhimurium LT2, section 65 of 220 of the complete genome. Length = 27863 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 43 caggcaattattgacg 58 |||||||||||||||| Sbjct: 11920 caggcaattattgacg 11935 >embl|AE006225|AE006225 Pasteurella multocida subsp. multocida str. Pm70 section 192 of 204 of the complete genome. Length = 11402 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 174 cagcgcgtttgacag 188 ||||||||||||||| Sbjct: 6222 cagcgcgtttgacag 6208 >embl|AE006204|AE006204 Pasteurella multocida subsp. multocida str. Pm70 section 171 of 204 of the complete genome. Length = 13594 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 21 ttccggcaacggaag 35 ||||||||||||||| Sbjct: 10484 ttccggcaacggaag 10470 >embl|AE006035|AE006035 Pasteurella multocida subsp. multocida str. Pm70 section 2 of 204 of the complete genome. Length = 11220 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 34 agtaatttacaggca 48 ||||||||||||||| Sbjct: 5055 agtaatttacaggca 5041 >AE012522 AE008922 |AE012522| Xanthomonas campestris pv. campestris str. ATCC 33913, section 430 of 460 of the complete genome. Length = 10895 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 171 cgccagcgcgtttga 185 ||||||||||||||| Sbjct: 10643 cgccagcgcgtttga 10657 >AE012520 AE008922 |AE012520| Xanthomonas campestris pv. campestris str. ATCC 33913, section 428 of 460 of the complete genome. Length = 11484 Score = 30.2 bits (15), Expect = 6.0 Identities = 18/19 (94%) Strand = Plus / Minus Query: 110 aggccgacgcgttcggcct 128 ||||||||||| ||||||| Sbjct: 2570 aggccgacgcgatcggcct 2552 >AE012469 AE008922 |AE012469| Xanthomonas campestris pv. campestris str. ATCC 33913, section 377 of 460 of the complete genome. Length = 10901 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 616 cagggctacgctgcc 630 ||||||||||||||| Sbjct: 9209 cagggctacgctgcc 9195 >AE012413 AE008922 |AE012413| Xanthomonas campestris pv. campestris str. ATCC 33913, section 321 of 460 of the complete genome. Length = 10624 Score = 30.2 bits (15), Expect = 6.0 Identities = 18/19 (94%) Strand = Plus / Plus Query: 239 ccgatgtggtcgtgctggc 257 |||| |||||||||||||| Sbjct: 4117 ccgaggtggtcgtgctggc 4135 >AE012390 AE008922 |AE012390| Xanthomonas campestris pv. campestris str. ATCC 33913, section 298 of 460 of the complete genome. Length = 10194 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 168 catcgccagcgcgtt 182 ||||||||||||||| Sbjct: 8037 catcgccagcgcgtt 8051 >AE012384 AE008922 |AE012384| Xanthomonas campestris pv. campestris str. ATCC 33913, section 292 of 460 of the complete genome. Length = 10909 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 591 gctggatggtcaacg 605 ||||||||||||||| Sbjct: 1937 gctggatggtcaacg 1951 >AE012353 AE008922 |AE012353| Xanthomonas campestris pv. campestris str. ATCC 33913, section 261 of 460 of the complete genome. Length = 10219 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 364 cgtcaggcgctggaa 378 ||||||||||||||| Sbjct: 3364 cgtcaggcgctggaa 3350 >AE012256 AE008922 |AE012256| Xanthomonas campestris pv. campestris str. ATCC 33913, section 164 of 460 of the complete genome. Length = 11894 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 599 gtcaacgtctgccgc 613 ||||||||||||||| Sbjct: 8298 gtcaacgtctgccgc 8284 >AE012233 AE008922 |AE012233| Xanthomonas campestris pv. campestris str. ATCC 33913, section 141 of 460 of the complete genome. Length = 13076 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 133 cgcgcccgccaggcg 147 ||||||||||||||| Sbjct: 7846 cgcgcccgccaggcg 7832 >AE012213 AE008922 |AE012213| Xanthomonas campestris pv. campestris str. ATCC 33913, section 121 of 460 of the complete genome. Length = 10877 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 605 gtctgccgccgcagg 619 ||||||||||||||| Sbjct: 8800 gtctgccgccgcagg 8786 >AE012175 AE008922 |AE012175| Xanthomonas campestris pv. campestris str. ATCC 33913, section 83 of 460 of the complete genome. Length = 13498 Score = 30.2 bits (15), Expect = 6.0 Identities = 18/19 (94%) Strand = Plus / Plus Query: 509 aaacccaggaacacgccat 527 |||||| |||||||||||| Sbjct: 828 aaaccctggaacacgccat 846 >AE012157 AE008922 |AE012157| Xanthomonas campestris pv. campestris str. ATCC 33913, section 65 of 460 of the complete genome. Length = 12504 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 121 ttcggccttgaacgc 135 ||||||||||||||| Sbjct: 7695 ttcggccttgaacgc 7709 >AE012138 AE008922 |AE012138| Xanthomonas campestris pv. campestris str. ATCC 33913, section 46 of 460 of the complete genome. Length = 13709 Score = 30.2 bits (15), Expect = 6.0 Identities = 18/19 (94%) Strand = Plus / Plus Query: 403 tcggtgcatttcgtcaccg 421 |||||| |||||||||||| Sbjct: 11792 tcggtgaatttcgtcaccg 11810 >AE012125 AE008922 |AE012125| Xanthomonas campestris pv. campestris str. ATCC 33913, section 33 of 460 of the complete genome. Length = 12110 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 372 gctggaaaatggcga 386 ||||||||||||||| Sbjct: 1053 gctggaaaatggcga 1067 >AE008904 AE006468 |AE008904| Salmonella typhimurium LT2, section 208 of 220 of the complete genome. Length = 20418 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 459 agtcccggtatttgc 473 ||||||||||||||| Sbjct: 7839 agtcccggtatttgc 7853 >AE008897 AE006468 |AE008897| Salmonella typhimurium LT2, section 201 of 220 of the complete genome. Length = 20409 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 171 cgccagcgcgtttga 185 ||||||||||||||| Sbjct: 9957 cgccagcgcgtttga 9943 >AE008875 AE006468 |AE008875| Salmonella typhimurium LT2, section 179 of 220 of the complete genome. Length = 22568 Score = 30.2 bits (15), Expect = 6.0 Identities = 18/19 (94%) Strand = Plus / Minus Query: 361 catcgtcaggcgctggaaa 379 ||||| ||||||||||||| Sbjct: 22234 catcgccaggcgctggaaa 22216 >AE008869 AE006468 |AE008869| Salmonella typhimurium LT2, section 173 of 220 of the complete genome. Length = 22072 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 550 tttgccgatggtcgt 564 ||||||||||||||| Sbjct: 11631 tttgccgatggtcgt 11617 >AE008866 AE006468 |AE008866| Salmonella typhimurium LT2, section 170 of 220 of the complete genome. Length = 20516 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 130 gaacgcgcccgccag 144 ||||||||||||||| Sbjct: 11709 gaacgcgcccgccag 11723 >AE008864 AE006468 |AE008864| Salmonella typhimurium LT2, section 168 of 220 of the complete genome. Length = 22530 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 520 cacgccatttatcca 534 ||||||||||||||| Sbjct: 742 cacgccatttatcca 756 >AE008860 AE006468 |AE008860| Salmonella typhimurium LT2, section 164 of 220 of the complete genome. Length = 21321 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 243 tgtggtcgtgctggc 257 ||||||||||||||| Sbjct: 20902 tgtggtcgtgctggc 20888 >AE008839 AE006468 |AE008839| Salmonella typhimurium LT2, section 143 of 220 of the complete genome. Length = 22400 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 606 tctgccgccgcaggg 620 ||||||||||||||| Sbjct: 18191 tctgccgccgcaggg 18177 >AE008823 AE006468 |AE008823| Salmonella typhimurium LT2, section 127 of 220 of the complete genome. Length = 19981 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 331 ctgctgccgaaatat 345 ||||||||||||||| Sbjct: 17760 ctgctgccgaaatat 17746 >AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section 111 of 220 of the complete genome. Length = 20167 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 170 tcgccagcgcgtttg 184 ||||||||||||||| Sbjct: 7712 tcgccagcgcgtttg 7726 >AE008806 AE006468 |AE008806| Salmonella typhimurium LT2, section 110 of 220 of the complete genome. Length = 21521 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 559 ggtcgtctgaaaatg 573 ||||||||||||||| Sbjct: 13305 ggtcgtctgaaaatg 13291 >AE008802 AE006468 |AE008802| Salmonella typhimurium LT2, section 106 of 220 of the complete genome. Length = 23759 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 322 cacccttctctgctg 336 ||||||||||||||| Sbjct: 8366 cacccttctctgctg 8380 >AE008787 AE006468 |AE008787| Salmonella typhimurium LT2, section 91 of 220 of the complete genome. Length = 24186 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 131 aacgcgcccgccagg 145 ||||||||||||||| Sbjct: 18765 aacgcgcccgccagg 18751 >AE008783 AE006468 |AE008783| Salmonella typhimurium LT2, section 87 of 220 of the complete genome. Length = 20050 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 595 gatggtcaacgtctg 609 ||||||||||||||| Sbjct: 6379 gatggtcaacgtctg 6365 >AE008775 AE006468 |AE008775| Salmonella typhimurium LT2, section 79 of 220 of the complete genome. Length = 21077 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 111 ggccgacgcgttcgg 125 ||||||||||||||| Sbjct: 7116 ggccgacgcgttcgg 7102 >AE008769 AE006468 |AE008769| Salmonella typhimurium LT2, section 73 of 220 of the complete genome. Length = 20665 Score = 30.2 bits (15), Expect = 6.0 Identities = 18/19 (94%) Strand = Plus / Minus Query: 367 caggcgctggaaaatggcg 385 ||||||||||||| ||||| Sbjct: 20100 caggcgctggaaagtggcg 20082 >AE008735 AE006468 |AE008735| Salmonella typhimurium LT2, section 43 of 220 of the complete genome. Length = 21697 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 362 atcgtcaggcgctgg 376 ||||||||||||||| Sbjct: 13983 atcgtcaggcgctgg 13997 >AE008723 AE006468 |AE008723| Salmonella typhimurium LT2, section 31 of 220 of the complete genome. Length = 22294 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 442 gttattttacaggcg 456 ||||||||||||||| Sbjct: 1641 gttattttacaggcg 1627 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 169 atcgccagcgcgttt 183 ||||||||||||||| Sbjct: 11801 atcgccagcgcgttt 11787 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 165 gctcatcgccagcgc 179 ||||||||||||||| Sbjct: 15526 gctcatcgccagcgc 15512 >AE008715 AE006468 |AE008715| Salmonella typhimurium LT2, section 23 of 220 of the complete genome. Length = 20951 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 92 gggcagttttcagca 106 ||||||||||||||| Sbjct: 11789 gggcagttttcagca 11803 >AE008711 AE006468 |AE008711| Salmonella typhimurium LT2, section 19 of 220 of the complete genome. Length = 20035 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 50 ttattgacgcctgta 64 ||||||||||||||| Sbjct: 5280 ttattgacgcctgta 5266 >AE008697 AE006468 |AE008697| Salmonella typhimurium LT2, section 5 of 220 of the complete genome. Length = 22892 Score = 30.2 bits (15), Expect = 6.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 301 gccgggcgtttgctg 315 ||||||||||||||| Sbjct: 14588 gccgggcgtttgctg 14602 Database: all Posted date: Nov 9, 2008 11:44 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 106,402 Number of extensions: 6462 Number of successful extensions: 53 Number of sequences better than 10.0: 47 Number of HSP's gapped: 52 Number of HSP's successfully gapped: 52 Length of query: 639 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 622 Effective length of database: 12,228,859 Effective search space: 7606350298 Effective search space used: 7606350298 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 15 (30.2 bits)