******************************************************************************** MAST - Motif Alignment and Search Tool ******************************************************************************** MAST version 4.10.1 (Release date: Wed Mar 25 11:40:43 2015 +1000) For further information on how to interpret these results or to get a copy of the MAST software please access http://meme-suite.org . ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Michael Gribskov, "Combining evidence using p-values: application to sequence homology searches", Bioinformatics, 14(48-54), 1998. ******************************************************************************** ******************************************************************************** DATABASE AND MOTIFS ******************************************************************************** DATABASE NC_014222.fasta (nucleotide) Last updated on Thu May 21 21:44:38 2015 Database contains 254 sequences, 8890 residues Scores for positive and reverse complement strands are combined. MOTIFS meme.xml (nucleotide) MOTIF WIDTH BEST POSSIBLE MATCH ----- ----- ------------------- 1 21 AACCACCTTTTCGGTGGTATC Random model letter frequencies (from non-redundant database): A 0.274 C 0.225 G 0.225 T 0.274 ******************************************************************************** ******************************************************************************** SECTION I: HIGH-SCORING SEQUENCES ******************************************************************************** - Each of the following 134 sequences has E-value less than 10. - The E-value of a sequence is the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database. - The combined p-value of a sequence measures the strength of the match of the sequence to all the motifs and is calculated by o finding the score of the single best match of each motif to the sequence (best matches may overlap), o calculating the sequence p-value of each score, o forming the product of the p-values, o taking the p-value of the product. - The sequence p-value of a score is defined as the probability of a random sequence of the same length containing some match with as good or better a score. - The score for the match of a position in a sequence to a motif is computed by by summing the appropriate entry from each column of the position-dependent scoring matrix that represents the motif. - Sequences shorter than one or more of the motifs are skipped. - The table is sorted by increasing E-value. ******************************************************************************** SEQUENCE NAME DESCRIPTION E-VALUE LENGTH ------------- ----------- -------- ------ complement(158087..158401) NC_014222 Methanococcus v... 0.00019 35 complement(309389..310438) NC_014222 Methanococcus v... 0.0025 35 complement(390526..391368) NC_014222 Methanococcus v... 0.0039 35 complement(1176739..1178574) NC_014222 Methanococcus v... 0.0058 35 complement(1193130..1194470) NC_014222 Methanococcus v... 0.0058 35 complement(1360769..1361533) NC_014222 Methanococcus v... 0.012 35 complement(1047242..1047757) NC_014222 Methanococcus v... 0.024 35 complement(1559357..1559908) NC_014222 Methanococcus v... 0.024 35 complement(1816848..1818122) NC_014222 Methanococcus v... 0.024 35 complement(1211586..1212317) NC_014222 Methanococcus v... 0.033 35 complement(1640126..1640716) NC_014222 Methanococcus v... 0.045 35 complement(1895487..1896164) NC_014222 Methanococcus v... 0.045 35 complement(410230..411204) NC_014222 Methanococcus v... 0.045 35 complement(954449..956599) NC_014222 Methanococcus v... 0.061 35 complement(1298841..1300418) NC_014222 Methanococcus v... 0.061 35 complement(1699438..1700625) NC_014222 Methanococcus v... 0.061 35 complement(614717..615388) NC_014222 Methanococcus v... 0.081 35 complement(1673282..1673488) NC_014222 Methanococcus v... 0.11 35 complement(1744787..1746358) NC_014222 Methanococcus v... 0.11 35 complement(418553..419143) NC_014222 Methanococcus v... 0.11 35 complement(998200..998934) NC_014222 Methanococcus v... 0.14 35 complement(1178765..1180579) NC_014222 Methanococcus v... 0.14 35 complement(1246772..1248019) NC_014222 Methanococcus v... 0.14 35 complement(144841..145641) NC_014222 Methanococcus v... 0.14 35 complement(1608352..1609884) NC_014222 Methanococcus v... 0.14 35 complement(163200..163958) NC_014222 Methanococcus v... 0.14 35 complement(48123..48503) NC_014222 Methanococcus v... 0.18 35 complement(112379..112759) NC_014222 Methanococcus v... 0.18 35 complement(1566199..1568262) NC_014222 Methanococcus v... 0.18 35 complement(1658686..1659168) NC_014222 Methanococcus v... 0.18 35 complement(1811068..1812474) NC_014222 Methanococcus v... 0.18 35 complement(1856429..1857283) NC_014222 Methanococcus v... 0.18 35 complement(997843..998091) NC_014222 Methanococcus v... 0.23 35 complement(1083764..1084372) NC_014222 Methanococcus v... 0.23 35 complement(1237650..1238819) NC_014222 Methanococcus v... 0.23 35 complement(1549566..1550516) NC_014222 Methanococcus v... 0.23 35 complement(1815469..1815777) NC_014222 Methanococcus v... 0.23 35 complement(405002..405451) NC_014222 Methanococcus v... 0.23 35 complement(802151..802906) NC_014222 Methanococcus v... 0.29 35 complement(1005172..1006035) NC_014222 Methanococcus v... 0.29 35 complement(1449335..1450030) NC_014222 Methanococcus v... 0.29 35 complement(630578..631417) NC_014222 Methanococcus v... 0.36 35 complement(785737..786264) NC_014222 Methanococcus v... 0.36 35 complement(465334..466110) NC_014222 Methanococcus v... 0.36 35 complement(1037557..1038213) NC_014222 Methanococcus v... 0.44 35 complement(1045281..1046888) NC_014222 Methanococcus v... 0.44 35 complement(1126314..1127549) NC_014222 Methanococcus v... 0.44 35 complement(1660129..1660530) NC_014222 Methanococcus v... 0.55 35 complement(1167558..1169741) NC_014222 Methanococcus v... 0.67 35 complement(1173860..1176526) NC_014222 Methanococcus v... 0.67 35 complement(1332908..1333885) NC_014222 Methanococcus v... 0.67 35 complement(1665641..1666534) NC_014222 Methanococcus v... 0.67 35 complement(1841424..1842287) NC_014222 Methanococcus v... 0.67 35 complement(1861801..1863093) NC_014222 Methanococcus v... 0.67 35 complement(1204223..1204879) NC_014222 Methanococcus v... 0.82 35 complement(1858715..1861525) NC_014222 Methanococcus v... 0.82 35 complement(1883870..1884703) NC_014222 Methanococcus v... 0.82 35 complement(174196..175077) NC_014222 Methanococcus v... 0.82 35 complement(1171284..1171853) NC_014222 Methanococcus v... 0.99 35 complement(295646..296998) NC_014222 Methanococcus v... 0.99 35 complement(1062092..1063258) NC_014222 Methanococcus v... 1.2 35 complement(1202153..1202479) NC_014222 Methanococcus v... 1.2 35 complement(1319680..1320780) NC_014222 Methanococcus v... 1.2 35 complement(1819575..1820954) NC_014222 Methanococcus v... 1.2 35 complement(543168..544157) NC_014222 Methanococcus v... 1.4 35 complement(965100..966299) NC_014222 Methanococcus v... 1.4 35 complement(1619439..1620728) NC_014222 Methanococcus v... 1.4 35 complement(1922351..1923052) NC_014222 Methanococcus v... 1.4 35 complement(357702..359186) NC_014222 Methanococcus v... 1.4 35 complement(1195519..1195983) NC_014222 Methanococcus v... 1.7 35 complement(1198206..1198610) NC_014222 Methanococcus v... 1.7 35 complement(1515298..1517112) NC_014222 Methanococcus v... 1.7 35 complement(1593054..1594913) NC_014222 Methanococcus v... 1.7 35 complement(1601836..1602960) NC_014222 Methanococcus v... 1.7 35 complement(1867055..1868401) NC_014222 Methanococcus v... 1.7 35 complement(1201732..1202130) NC_014222 Methanococcus v... 2 35 complement(1546236..1546652) NC_014222 Methanococcus v... 2 35 complement(313781..314458) NC_014222 Methanococcus v... 2 35 complement(631504..632511) NC_014222 Methanococcus v... 2.4 35 complement(1035848..1036504) NC_014222 Methanococcus v... 2.4 35 complement(1357187..1357528) NC_014222 Methanococcus v... 2.4 35 complement(1561189..1562124) NC_014222 Methanococcus v... 2.4 35 complement(1813286..1814140) NC_014222 Methanococcus v... 2.4 35 complement(226853..228475) NC_014222 Methanococcus v... 2.4 35 complement(1187886..1188536) NC_014222 Methanococcus v... 2.8 35 complement(1196819..1197403) NC_014222 Methanococcus v... 2.8 35 complement(1198619..1199167) NC_014222 Methanococcus v... 2.8 35 complement(1351930..1352841) NC_014222 Methanococcus v... 2.8 35 complement(1857517..1858341) NC_014222 Methanococcus v... 2.8 35 complement(1171869..1172168) NC_014222 Methanococcus v... 3.2 35 complement(1199858..1200403) NC_014222 Methanococcus v... 3.2 35 complement(1509644..1510675) NC_014222 Methanococcus v... 3.2 35 complement(1839217..1840167) NC_014222 Methanococcus v... 3.2 35 complement(374033..374431) NC_014222 Methanococcus v... 3.2 35 complement(837376..838173) NC_014222 Methanococcus v... 3.8 35 complement(92406..94217) NC_014222 Methanococcus v... 3.8 35 complement(1427328..1428338) NC_014222 Methanococcus v... 3.8 35 complement(164129..165406) NC_014222 Methanococcus v... 3.8 35 complement(1848811..1849617) NC_014222 Methanococcus v... 3.8 35 complement(315081..315791) NC_014222 Methanococcus v... 3.8 35 complement(28150..29961) NC_014222 Methanococcus v... 3.8 35 complement(623175..624596) NC_014222 Methanococcus v... 4.4 35 complement(1169951..1170532) NC_014222 Methanococcus v... 4.4 35 complement(1196144..1196809) NC_014222 Methanococcus v... 4.4 35 complement(1202929..1203291) NC_014222 Methanococcus v... 4.4 35 complement(1452900..1453556) NC_014222 Methanococcus v... 4.4 35 complement(1496000..1496995) NC_014222 Methanococcus v... 4.4 35 complement(1697464..1698780) NC_014222 Methanococcus v... 4.4 35 complement(1929466..1931577) NC_014222 Methanococcus v... 4.4 35 complement(897258..898247) NC_014222 Methanococcus v... 5 35 complement(212655..213482) NC_014222 Methanococcus v... 5 35 complement(594626..594889) NC_014222 Methanococcus v... 5.8 35 complement(1137201..1138973) NC_014222 Methanococcus v... 5.8 35 complement(1650808..1651512) NC_014222 Methanococcus v... 5.8 35 complement(1655929..1658274) NC_014222 Methanococcus v... 5.8 35 complement(1902159..1902800) NC_014222 Methanococcus v... 5.8 35 complement(308047..309225) NC_014222 Methanococcus v... 5.8 35 complement(854109..855680) NC_014222 Methanococcus v... 6.6 35 complement(1345376..1347136) NC_014222 Methanococcus v... 6.6 35 complement(1912354..1913886) NC_014222 Methanococcus v... 6.6 35 complement(771128..771964) NC_014222 Methanococcus v... 7.6 35 complement(1355495..1355866) NC_014222 Methanococcus v... 7.6 35 complement(1386628..1387215) NC_014222 Methanococcus v... 7.6 35 complement(1919186..1920301) NC_014222 Methanococcus v... 7.6 35 complement(237779..239137) NC_014222 Methanococcus v... 7.6 35 complement(293566..295503) NC_014222 Methanococcus v... 7.6 35 complement(1121859..1122719) NC_014222 Methanococcus v... 8.6 35 complement(1201342..1201701) NC_014222 Methanococcus v... 8.6 35 complement(1264728..1266080) NC_014222 Methanococcus v... 8.6 35 complement(1875820..1878459) NC_014222 Methanococcus v... 8.6 35 complement(1903948..1904247) NC_014222 Methanococcus v... 8.6 35 complement(1187140..1187745) NC_014222 Methanococcus v... 9.7 35 complement(1823172..1823963) NC_014222 Methanococcus v... 9.7 35 complement(1849907..1850932) NC_014222 Methanococcus v... 9.7 35 ******************************************************************************** ******************************************************************************** SECTION II: MOTIF DIAGRAMS ******************************************************************************** - The ordering and spacing of all non-overlapping motif occurrences are shown for each high-scoring sequence listed in Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001. - The POSITION p-value of a match is the probability of a single random subsequence of the length of the motif scoring at least as well as the observed match. - For each sequence, all motif occurrences are shown unless there are overlaps. In that case, a motif occurrence is shown only if its p-value is less than the product of the p-values of the other (lower-numbered) motif occurrences that it overlaps. - The table also shows the E-value of each sequence. - Spacers and motif occurences are indicated by o -d- `d' residues separate the end of the preceding motif occurrence and the start of the following motif occurrence o [sn] occurrence of motif `n' with p-value less than 0.0001. A minus sign indicates that the occurrence is on the reverse complement strand. ******************************************************************************** SEQUENCE NAME E-VALUE MOTIF DIAGRAM ------------- -------- ------------- complement(158087..158401) 0.00019 13_[+1]_1 complement(309389..310438) 0.0025 13_[+1]_1 complement(390526..391368) 0.0039 14_[+1]_0 complement(1176739..1178574) 0.0058 12_[+1]_2 complement(1193130..1194470) 0.0058 14_[+1]_0 complement(1360769..1361533) 0.012 14_[+1]_0 complement(1047242..1047757) 0.024 14_[+1]_0 complement(1559357..1559908) 0.024 12_[+1]_2 complement(1816848..1818122) 0.024 14_[+1]_0 complement(1211586..1212317) 0.033 14_[+1]_0 complement(1640126..1640716) 0.045 14_[+1]_0 complement(1895487..1896164) 0.045 14_[+1]_0 complement(410230..411204) 0.045 14_[+1]_0 complement(954449..956599) 0.061 14_[+1]_0 complement(1298841..1300418) 0.061 14_[+1]_0 complement(1699438..1700625) 0.061 14_[+1]_0 complement(614717..615388) 0.081 14_[+1]_0 complement(1673282..1673488) 0.11 14_[+1]_0 complement(1744787..1746358) 0.11 14_[+1]_0 complement(418553..419143) 0.11 14_[+1]_0 complement(998200..998934) 0.14 14_[+1]_0 complement(1178765..1180579) 0.14 13_[+1]_1 complement(1246772..1248019) 0.14 14_[+1]_0 complement(144841..145641) 0.14 14_[+1]_0 complement(1608352..1609884) 0.14 14_[+1]_0 complement(163200..163958) 0.14 13_[+1]_1 complement(48123..48503) 0.18 14_[+1]_0 complement(112379..112759) 0.18 14_[+1]_0 complement(1566199..1568262) 0.18 14_[+1]_0 complement(1658686..1659168) 0.18 13_[+1]_1 complement(1811068..1812474) 0.18 14_[+1]_0 complement(1856429..1857283) 0.18 14_[+1]_0 complement(997843..998091) 0.23 13_[+1]_1 complement(1083764..1084372) 0.23 13_[+1]_1 complement(1237650..1238819) 0.23 14_[+1]_0 complement(1549566..1550516) 0.23 14_[+1]_0 complement(1815469..1815777) 0.23 14_[+1]_0 complement(405002..405451) 0.23 14_[+1]_0 complement(802151..802906) 0.29 14_[+1]_0 complement(1005172..1006035) 0.29 14_[+1]_0 complement(1449335..1450030) 0.29 14_[+1]_0 complement(630578..631417) 0.36 14_[+1]_0 complement(785737..786264) 0.36 14_[+1]_0 complement(465334..466110) 0.36 14_[+1]_0 complement(1037557..1038213) 0.44 14_[+1]_0 complement(1045281..1046888) 0.44 10_[+1]_4 complement(1126314..1127549) 0.44 14_[+1]_0 complement(1660129..1660530) 0.55 14_[+1]_0 complement(1167558..1169741) 0.67 14_[+1]_0 complement(1173860..1176526) 0.67 14_[+1]_0 complement(1332908..1333885) 0.67 14_[+1]_0 complement(1665641..1666534) 0.67 14_[+1]_0 complement(1841424..1842287) 0.67 14_[+1]_0 complement(1861801..1863093) 0.67 14_[+1]_0 complement(1204223..1204879) 0.82 35 complement(1858715..1861525) 0.82 35 complement(1883870..1884703) 0.82 35 complement(174196..175077) 0.82 35 complement(1171284..1171853) 0.99 35 complement(295646..296998) 0.99 35 complement(1062092..1063258) 1.2 35 complement(1202153..1202479) 1.2 35 complement(1319680..1320780) 1.2 35 complement(1819575..1820954) 1.2 35 complement(543168..544157) 1.4 35 complement(965100..966299) 1.4 35 complement(1619439..1620728) 1.4 35 complement(1922351..1923052) 1.4 35 complement(357702..359186) 1.4 35 complement(1195519..1195983) 1.7 35 complement(1198206..1198610) 1.7 35 complement(1515298..1517112) 1.7 35 complement(1593054..1594913) 1.7 35 complement(1601836..1602960) 1.7 35 complement(1867055..1868401) 1.7 35 complement(1201732..1202130) 2 35 complement(1546236..1546652) 2 35 complement(313781..314458) 2 35 complement(631504..632511) 2.4 35 complement(1035848..1036504) 2.4 35 complement(1357187..1357528) 2.4 35 complement(1561189..1562124) 2.4 35 complement(1813286..1814140) 2.4 35 complement(226853..228475) 2.4 35 complement(1187886..1188536) 2.8 35 complement(1196819..1197403) 2.8 35 complement(1198619..1199167) 2.8 35 complement(1351930..1352841) 2.8 35 complement(1857517..1858341) 2.8 35 complement(1171869..1172168) 3.2 35 complement(1199858..1200403) 3.2 35 complement(1509644..1510675) 3.2 35 complement(1839217..1840167) 3.2 35 complement(374033..374431) 3.2 35 complement(837376..838173) 3.8 35 complement(92406..94217) 3.8 35 complement(1427328..1428338) 3.8 35 complement(164129..165406) 3.8 35 complement(1848811..1849617) 3.8 35 complement(315081..315791) 3.8 35 complement(28150..29961) 3.8 35 complement(623175..624596) 4.4 35 complement(1169951..1170532) 4.4 35 complement(1196144..1196809) 4.4 35 complement(1202929..1203291) 4.4 35 complement(1452900..1453556) 4.4 35 complement(1496000..1496995) 4.4 35 complement(1697464..1698780) 4.4 35 complement(1929466..1931577) 4.4 35 complement(897258..898247) 5 35 complement(212655..213482) 5 35 complement(594626..594889) 5.8 35 complement(1137201..1138973) 5.8 35 complement(1650808..1651512) 5.8 35 complement(1655929..1658274) 5.8 35 complement(1902159..1902800) 5.8 35 complement(308047..309225) 5.8 35 complement(854109..855680) 6.6 35 complement(1345376..1347136) 6.6 35 complement(1912354..1913886) 6.6 35 complement(771128..771964) 7.6 35 complement(1355495..1355866) 7.6 35 complement(1386628..1387215) 7.6 35 complement(1919186..1920301) 7.6 35 complement(237779..239137) 7.6 35 complement(293566..295503) 7.6 35 complement(1121859..1122719) 8.6 35 complement(1201342..1201701) 8.6 35 complement(1264728..1266080) 8.6 35 complement(1875820..1878459) 8.6 35 complement(1903948..1904247) 8.6 35 complement(1187140..1187745) 9.7 35 complement(1823172..1823963) 9.7 35 complement(1849907..1850932) 9.7 35 ******************************************************************************** ******************************************************************************** SECTION III: ANNOTATED SEQUENCES ******************************************************************************** - The positions and p-values of the non-overlapping motif occurrences are shown above the actual sequence for each of the high-scoring sequences from Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001 as defined in Section II. - For each sequence, the first line specifies the name of the sequence. - The second (and possibly more) lines give a description of the sequence. - Following the description line(s) is a line giving the length, combined p-value, and E-value of the sequence as defined in Section I. - The next line reproduces the motif diagram from Section II. - The entire sequence is printed on the following lines. - Motif occurrences are indicated directly above their positions in the sequence on lines showing o the motif number of the occurrence (a minus sign indicates that the occurrence is on the reverse complement strand), o the position p-value of the occurrence, o the best possible match to the motif (or its reverse complement), and o columns whose match to the motif has a positive score (indicated by a plus sign). ******************************************************************************** complement(158087..158401) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 7.66e-07 E-VALUE = 0.00019 DIAGRAM: 13_[+1]_1 [+1] 2.6e-08 AACCACCTTTTCGGTGGTATC ++ ++++++++++++++++++ 1 TTGAGATTATATGAAATACCTTTTAGGTGGTATTC complement(309389..310438) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.93e-06 E-VALUE = 0.0025 DIAGRAM: 13_[+1]_1 [+1] 3.3e-07 AACCACCTTTTCGGTGGTATC + ++++++ ++++++++ + + 1 ATAAAATTAAAAAACCTACCTATTAGGTGAAAATA complement(390526..391368) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.52e-05 E-VALUE = 0.0039 DIAGRAM: 14_[+1]_0 [+1] 5.1e-07 AACCACCTTTTCGGTGGTATC ++ +++++ + ++++++ + + 1 TAATTAAACAACCAATACACTTATAAGGTGAAAAT complement(1176739..1178574) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-05 E-VALUE = 0.0058 DIAGRAM: 12_[+1]_2 [+1] 7.6e-07 AACCACCTTTTCGGTGGTATC ++++++++ +++++++ + + 1 AATAATTAAAAAATTTACCTCATAGGTGAAAATTT complement(1193130..1194470) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-05 E-VALUE = 0.0058 DIAGRAM: 14_[+1]_0 [+1] 7.6e-07 AACCACCTTTTCGGTGGTATC +++++++++ ++++++++ ++ 1 AGGATGAAACACAAAATTAATTTATCGGTGGTTTT complement(1360769..1361533) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.83e-05 E-VALUE = 0.012 DIAGRAM: 14_[+1]_0 [+1] 1.6e-06 AACCACCTTTTCGGTGGTATC +++++++ ++++++++++ + 1 ATGTAGTTTCAATATTTTAATTATTAGGTGATAAT complement(1047242..1047757) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.57e-05 E-VALUE = 0.024 DIAGRAM: 14_[+1]_0 [+1] 3.2e-06 AACCACCTTTTCGGTGGTATC +++++++++ +++++++ ++ 1 TAATTTTATGTTTATATTAATTTTAAGGTGATTTT complement(1559357..1559908) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.57e-05 E-VALUE = 0.024 DIAGRAM: 12_[+1]_2 [+1] 3.2e-06 AACCACCTTTTCGGTGGTATC + ++++ + +++++++++ + 1 TAAATTATGGGTTAATAATATATAGGTGGTAATAG complement(1816848..1818122) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.57e-05 E-VALUE = 0.024 DIAGRAM: 14_[+1]_0 [+1] 3.2e-06 AACCACCTTTTCGGTGGTATC ++ +++ + ++++++++++ 1 AATGTTAAAAACGTAAAAAATAATGAGGTGATATC complement(1211586..1212317) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.32e-04 E-VALUE = 0.033 DIAGRAM: 14_[+1]_0 [+1] 4.4e-06 AACCACCTTTTCGGTGGTATC +++ + ++ +++++++++ + 1 ATCTATATCAATAAAACGATTTAATCGGTGATAAC complement(1640126..1640716) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.79e-04 E-VALUE = 0.045 DIAGRAM: 14_[+1]_0 [+1] 6.0e-06 AACCACCTTTTCGGTGGTATC ++ +++ ++ +++++++++ 1 TTCAATACAATTTAAAACCAGATTATGGTGATATT complement(1895487..1896164) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.79e-04 E-VALUE = 0.045 DIAGRAM: 14_[+1]_0 [+1] 6.0e-06 AACCACCTTTTCGGTGGTATC +++ ++ +++++++++ 1 ATATTAAATAACGTAATAACAAAACTGGTGATATT complement(410230..411204) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.79e-04 E-VALUE = 0.045 DIAGRAM: 14_[+1]_0 [+1] 6.0e-06 AACCACCTTTTCGGTGGTATC ++ +++++ ++++++ ++ 1 AATAAAATAGTAAAATAAAATTTAACGGTGAAATA complement(954449..956599) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.40e-04 E-VALUE = 0.061 DIAGRAM: 14_[+1]_0 [+1] 8.0e-06 AACCACCTTTTCGGTGGTATC +++ + + +++++++++ ++ 1 TATAAAGTTAATATAATAATTAATTCGGTGATTTT complement(1298841..1300418) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.40e-04 E-VALUE = 0.061 DIAGRAM: 14_[+1]_0 [+1] 8.0e-06 AACCACCTTTTCGGTGGTATC + +++++ + +++++ +++ 1 GTAATATTTATATGTAATAATTAATTGGTGAAATT complement(1699438..1700625) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.40e-04 E-VALUE = 0.061 DIAGRAM: 14_[+1]_0 [+1] 8.0e-06 AACCACCTTTTCGGTGGTATC +++++ + + ++++++ + + 1 CGATAAAAATCGATAATTATCAATAAGGTGAAAAT complement(614717..615388) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.18e-04 E-VALUE = 0.081 DIAGRAM: 14_[+1]_0 [+1] 1.1e-05 AACCACCTTTTCGGTGGTATC +++++++ + + +++++ +++ 1 TTGAAAATTTATAAAATTAATCTATTGGTGAAATT complement(1673282..1673488) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.18e-04 E-VALUE = 0.11 DIAGRAM: 14_[+1]_0 [+1] 1.4e-05 AACCACCTTTTCGGTGGTATC ++ + + +++ +++++ +++ 1 TATAAATAATAATTTATAATTATTTTGGTGGAATT complement(1744787..1746358) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.18e-04 E-VALUE = 0.11 DIAGRAM: 14_[+1]_0 [+1] 1.4e-05 AACCACCTTTTCGGTGGTATC ++ +++ + +++++++++ 1 AAAATTTACTAAATAAATACGATAATGGTGATATT complement(418553..419143) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.18e-04 E-VALUE = 0.11 DIAGRAM: 14_[+1]_0 [+1] 1.4e-05 AACCACCTTTTCGGTGGTATC +++ +++ ++++++ + 1 TAACCCATATCGATATTAACCACAAAGGTGAAAAA complement(998200..998934) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.14 DIAGRAM: 14_[+1]_0 [+1] 1.8e-05 AACCACCTTTTCGGTGGTATC + + + + ++++++++ + 1 ATATTAATAGTAATACTAATAATAAAGGTGATAAT complement(1178765..1180579) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.14 DIAGRAM: 13_[+1]_1 [+1] 1.8e-05 AACCACCTTTTCGGTGGTATC + +++++ ++++++ + + 1 ATTAAAAGTTAATTTGAACTTTAAAGGTGAAAACC complement(1246772..1248019) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.14 DIAGRAM: 14_[+1]_0 [+1] 1.8e-05 AACCACCTTTTCGGTGGTATC ++ ++++++ + ++++ ++ 1 TAAGTATGTATAAAAAACAACTTATTGGTGTTAAA complement(144841..145641) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.14 DIAGRAM: 14_[+1]_0 [+1] 1.8e-05 AACCACCTTTTCGGTGGTATC + +++ ++++++++ + 1 CAGAATAAATTTATTCCGAATACACAGGTGATAAC complement(1608352..1609884) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.14 DIAGRAM: 14_[+1]_0 [+1] 1.8e-05 AACCACCTTTTCGGTGGTATC ++ ++ +++ +++++++ + 1 AAAAAATCAAAGATATAATATATTTTGGTGATAAT complement(163200..163958) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.14 DIAGRAM: 13_[+1]_1 [+1] 1.8e-05 AACCACCTTTTCGGTGGTATC + +++++ ++++++ +++ 1 TAATTGTTGAACTTAAAAATTTAAAGGTGAGATTA complement(48123..48503) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.97e-04 E-VALUE = 0.18 DIAGRAM: 14_[+1]_0 [+1] 2.3e-05 AACCACCTTTTCGGTGGTATC ++ +++++ ++ +++++ + 1 TACTGTTATGATAAAAATAATTATTTGGTGAAAAA complement(112379..112759) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.97e-04 E-VALUE = 0.18 DIAGRAM: 14_[+1]_0 [+1] 2.3e-05 AACCACCTTTTCGGTGGTATC ++ +++++ ++ +++++ + 1 TACTGTTATGATAAAAATAATTATTTGGTGAAAAA complement(1566199..1568262) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.97e-04 E-VALUE = 0.18 DIAGRAM: 14_[+1]_0 [+1] 2.3e-05 AACCACCTTTTCGGTGGTATC ++++ ++ ++++++++ + 1 ATATTTAACCAATATTTTATTTAGTCGGTGATTAT complement(1658686..1659168) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.97e-04 E-VALUE = 0.18 DIAGRAM: 13_[+1]_1 [+1] 2.3e-05 AACCACCTTTTCGGTGGTATC ++ ++ + + ++++++++++ 1 TTAAACTAAAACTTTTAAAGTATGAGGTGATATCT complement(1811068..1812474) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.97e-04 E-VALUE = 0.18 DIAGRAM: 14_[+1]_0 [+1] 2.3e-05 AACCACCTTTTCGGTGGTATC + +++ +++++ +++ 1 ATAAAACATTTTAGTTAAAATAAAATGGTGAAATT complement(1856429..1857283) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.97e-04 E-VALUE = 0.18 DIAGRAM: 14_[+1]_0 [+1] 2.3e-05 AACCACCTTTTCGGTGGTATC ++ ++++ ++++++ ++ 1 TAATTACTAAATGTATATCATAAAAAGGTGAATTT complement(997843..998091) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 8.89e-04 E-VALUE = 0.23 DIAGRAM: 13_[+1]_1 [+1] 3.0e-05 AACCACCTTTTCGGTGGTATC ++ ++ +++ +++++ ++ 1 TTTAATATTTTATATAATCCATTTTGGTGAAATAA complement(1083764..1084372) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 8.89e-04 E-VALUE = 0.23 DIAGRAM: 13_[+1]_1 [+1] 3.0e-05 AACCACCTTTTCGGTGGTATC +++++ +++ +++++ + + 1 AAACACAATGATAATTTATAATTTTGGTGGAACCT complement(1237650..1238819) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 8.89e-04 E-VALUE = 0.23 DIAGRAM: 14_[+1]_0 [+1] 3.0e-05 AACCACCTTTTCGGTGGTATC +++++++ +++++++ + 1 AACATTATATGTGGTATTAATTAAAAGGTGATTTA complement(1549566..1550516) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 8.89e-04 E-VALUE = 0.23 DIAGRAM: 14_[+1]_0 [+1] 3.0e-05 AACCACCTTTTCGGTGGTATC ++ ++++++ +++++++++ 1 ATAATCAATATCTTATAAAATTTTAAGGTGGTATG complement(1815469..1815777) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 8.89e-04 E-VALUE = 0.23 DIAGRAM: 14_[+1]_0 [+1] 3.0e-05 AACCACCTTTTCGGTGGTATC ++ + ++ +++++++++ 1 ATTTAATTAGAATTTATAATAATTGCGGTGATATA complement(405002..405451) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 8.89e-04 E-VALUE = 0.23 DIAGRAM: 14_[+1]_0 [+1] 3.0e-05 AACCACCTTTTCGGTGGTATC ++ + + + +++++ +++ 1 AAATATAAAAATATAAAAATATATATGGTGAAATT complement(802151..802906) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.12e-03 E-VALUE = 0.29 DIAGRAM: 14_[+1]_0 [+1] 3.7e-05 AACCACCTTTTCGGTGGTATC +++++ + ++++++ + 1 ATGGTTTAAAATATAATCATAATGCTGGTGATTAT complement(1005172..1006035) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.12e-03 E-VALUE = 0.29 DIAGRAM: 14_[+1]_0 [+1] 3.7e-05 AACCACCTTTTCGGTGGTATC ++++ + +++++++ 1 TAATCATATGAATATATCATAATACTGGTGATAAA complement(1449335..1450030) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.12e-03 E-VALUE = 0.29 DIAGRAM: 14_[+1]_0 [+1] 3.7e-05 AACCACCTTTTCGGTGGTATC ++ ++ +++++++ +++ 1 AAAAATAAAGTAAGTTTATTATTATCGGTGAAATT complement(630578..631417) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.41e-03 E-VALUE = 0.36 DIAGRAM: 14_[+1]_0 [+1] 4.7e-05 AACCACCTTTTCGGTGGTATC +++ + + + ++++++++ 1 TATAATTACTATGGATTATCATATATGGTGATATA complement(785737..786264) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.41e-03 E-VALUE = 0.36 DIAGRAM: 14_[+1]_0 [+1] 4.7e-05 AACCACCTTTTCGGTGGTATC +++++ + + +++++ + + 1 TTAAATTTTAAAATTATCAAATCTAAGGTGTAAAT complement(465334..466110) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.41e-03 E-VALUE = 0.36 DIAGRAM: 14_[+1]_0 [+1] 4.7e-05 AACCACCTTTTCGGTGGTATC +++ + +++ +++++ +++ 1 ACAATAACCAAAAAATTAATTTTAAAGGTGTAATT complement(1037557..1038213) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.75e-03 E-VALUE = 0.44 DIAGRAM: 14_[+1]_0 [+1] 5.8e-05 AACCACCTTTTCGGTGGTATC +++++++ ++ +++++ + + 1 GATTCAAAAATAGGAATTCATATTGAGGTGTAACC complement(1045281..1046888) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.75e-03 E-VALUE = 0.44 DIAGRAM: 10_[+1]_4 [+1] 5.8e-05 AACCACCTTTTCGGTGGTATC +++++++ +++ ++ ++ + 1 AAAGTCAAGAAACCACTATTTTGGAGGAAAAAAAC complement(1126314..1127549) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.75e-03 E-VALUE = 0.44 DIAGRAM: 14_[+1]_0 [+1] 5.8e-05 AACCACCTTTTCGGTGGTATC +++ + + +++++++ +++ 1 TTGAAAATTTTATAATCAATATATTAGGTGTAATT complement(1660129..1660530) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.16e-03 E-VALUE = 0.55 DIAGRAM: 14_[+1]_0 [+1] 7.2e-05 AACCACCTTTTCGGTGGTATC ++ +++ + ++++ ++++ 1 TAATAGATAACTAAAAATAAAAATATGGTGTTATT complement(1167558..1169741) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.65e-03 E-VALUE = 0.67 DIAGRAM: 14_[+1]_0 [+1] 8.8e-05 AACCACCTTTTCGGTGGTATC ++ + + ++++++ + + 1 AAAAATCAAAAACATATATAAATACAGGTGACAAT complement(1173860..1176526) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.65e-03 E-VALUE = 0.67 DIAGRAM: 14_[+1]_0 [+1] 8.8e-05 AACCACCTTTTCGGTGGTATC +++++ ++ + +++++ + 1 ATATTATAATTTAAATTCATATTCTGGGTGAAAAA complement(1332908..1333885) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.65e-03 E-VALUE = 0.67 DIAGRAM: 14_[+1]_0 [+1] 8.8e-05 AACCACCTTTTCGGTGGTATC ++ + ++ ++++++ ++++ + 1 ACTAATTAATTTACAAATGCTATTTAGGGGATAAT complement(1665641..1666534) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.65e-03 E-VALUE = 0.67 DIAGRAM: 14_[+1]_0 [+1] 8.8e-05 AACCACCTTTTCGGTGGTATC + +++++ ++++++ +++ 1 ATAATCTATTTTAAAGATAACTAATAGGTGTAATT complement(1841424..1842287) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.65e-03 E-VALUE = 0.67 DIAGRAM: 14_[+1]_0 [+1] 8.8e-05 AACCACCTTTTCGGTGGTATC ++++ + + + +++++++ 1 TAAAAATACATTTTATTTTAAATATTGGTGATAAA complement(1861801..1863093) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.65e-03 E-VALUE = 0.67 DIAGRAM: 14_[+1]_0 [+1] 8.8e-05 AACCACCTTTTCGGTGGTATC +++ ++ +++++++ + + 1 AATATCATAAAAATTATTTATCAATCGGTGAAACT complement(1204223..1204879) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.23e-03 E-VALUE = 0.82 DIAGRAM: 35 complement(1858715..1861525) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.23e-03 E-VALUE = 0.82 DIAGRAM: 35 complement(1883870..1884703) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.23e-03 E-VALUE = 0.82 DIAGRAM: 35 complement(174196..175077) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.23e-03 E-VALUE = 0.82 DIAGRAM: 35 complement(1171284..1171853) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.90e-03 E-VALUE = 0.99 DIAGRAM: 35 complement(295646..296998) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.90e-03 E-VALUE = 0.99 DIAGRAM: 35 complement(1062092..1063258) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.70e-03 E-VALUE = 1.2 DIAGRAM: 35 complement(1202153..1202479) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.70e-03 E-VALUE = 1.2 DIAGRAM: 35 complement(1319680..1320780) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.70e-03 E-VALUE = 1.2 DIAGRAM: 35 complement(1819575..1820954) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 4.70e-03 E-VALUE = 1.2 DIAGRAM: 35 complement(543168..544157) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.62e-03 E-VALUE = 1.4 DIAGRAM: 35 complement(965100..966299) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.62e-03 E-VALUE = 1.4 DIAGRAM: 35 complement(1619439..1620728) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.62e-03 E-VALUE = 1.4 DIAGRAM: 35 complement(1922351..1923052) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.62e-03 E-VALUE = 1.4 DIAGRAM: 35 complement(357702..359186) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 5.62e-03 E-VALUE = 1.4 DIAGRAM: 35 complement(1195519..1195983) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.69e-03 E-VALUE = 1.7 DIAGRAM: 35 complement(1198206..1198610) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.69e-03 E-VALUE = 1.7 DIAGRAM: 35 complement(1515298..1517112) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.69e-03 E-VALUE = 1.7 DIAGRAM: 35 complement(1593054..1594913) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.69e-03 E-VALUE = 1.7 DIAGRAM: 35 complement(1601836..1602960) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.69e-03 E-VALUE = 1.7 DIAGRAM: 35 complement(1867055..1868401) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 6.69e-03 E-VALUE = 1.7 DIAGRAM: 35 complement(1201732..1202130) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 7.92e-03 E-VALUE = 2 DIAGRAM: 35 complement(1546236..1546652) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 7.92e-03 E-VALUE = 2 DIAGRAM: 35 complement(313781..314458) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 7.92e-03 E-VALUE = 2 DIAGRAM: 35 complement(631504..632511) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.33e-03 E-VALUE = 2.4 DIAGRAM: 35 complement(1035848..1036504) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.33e-03 E-VALUE = 2.4 DIAGRAM: 35 complement(1357187..1357528) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.33e-03 E-VALUE = 2.4 DIAGRAM: 35 complement(1561189..1562124) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.33e-03 E-VALUE = 2.4 DIAGRAM: 35 complement(1813286..1814140) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.33e-03 E-VALUE = 2.4 DIAGRAM: 35 complement(226853..228475) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 9.33e-03 E-VALUE = 2.4 DIAGRAM: 35 complement(1187886..1188536) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.09e-02 E-VALUE = 2.8 DIAGRAM: 35 complement(1196819..1197403) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.09e-02 E-VALUE = 2.8 DIAGRAM: 35 complement(1198619..1199167) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.09e-02 E-VALUE = 2.8 DIAGRAM: 35 complement(1351930..1352841) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.09e-02 E-VALUE = 2.8 DIAGRAM: 35 complement(1857517..1858341) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.09e-02 E-VALUE = 2.8 DIAGRAM: 35 complement(1171869..1172168) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.28e-02 E-VALUE = 3.2 DIAGRAM: 35 complement(1199858..1200403) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.28e-02 E-VALUE = 3.2 DIAGRAM: 35 complement(1509644..1510675) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.28e-02 E-VALUE = 3.2 DIAGRAM: 35 complement(1839217..1840167) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.28e-02 E-VALUE = 3.2 DIAGRAM: 35 complement(374033..374431) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.28e-02 E-VALUE = 3.2 DIAGRAM: 35 complement(837376..838173) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(92406..94217) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(1427328..1428338) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(164129..165406) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(1848811..1849617) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(315081..315791) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(28150..29961) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.49e-02 E-VALUE = 3.8 DIAGRAM: 35 complement(623175..624596) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1169951..1170532) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1196144..1196809) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1202929..1203291) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1452900..1453556) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1496000..1496995) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1697464..1698780) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(1929466..1931577) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.72e-02 E-VALUE = 4.4 DIAGRAM: 35 complement(897258..898247) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.98e-02 E-VALUE = 5 DIAGRAM: 35 complement(212655..213482) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 1.98e-02 E-VALUE = 5 DIAGRAM: 35 complement(594626..594889) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-02 E-VALUE = 5.8 DIAGRAM: 35 complement(1137201..1138973) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-02 E-VALUE = 5.8 DIAGRAM: 35 complement(1650808..1651512) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-02 E-VALUE = 5.8 DIAGRAM: 35 complement(1655929..1658274) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-02 E-VALUE = 5.8 DIAGRAM: 35 complement(1902159..1902800) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-02 E-VALUE = 5.8 DIAGRAM: 35 complement(308047..309225) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.28e-02 E-VALUE = 5.8 DIAGRAM: 35 complement(854109..855680) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.61e-02 E-VALUE = 6.6 DIAGRAM: 35 complement(1345376..1347136) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.61e-02 E-VALUE = 6.6 DIAGRAM: 35 complement(1912354..1913886) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.61e-02 E-VALUE = 6.6 DIAGRAM: 35 complement(771128..771964) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.98e-02 E-VALUE = 7.6 DIAGRAM: 35 complement(1355495..1355866) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.98e-02 E-VALUE = 7.6 DIAGRAM: 35 complement(1386628..1387215) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.98e-02 E-VALUE = 7.6 DIAGRAM: 35 complement(1919186..1920301) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.98e-02 E-VALUE = 7.6 DIAGRAM: 35 complement(237779..239137) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.98e-02 E-VALUE = 7.6 DIAGRAM: 35 complement(293566..295503) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 2.98e-02 E-VALUE = 7.6 DIAGRAM: 35 complement(1121859..1122719) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.38e-02 E-VALUE = 8.6 DIAGRAM: 35 complement(1201342..1201701) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.38e-02 E-VALUE = 8.6 DIAGRAM: 35 complement(1264728..1266080) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.38e-02 E-VALUE = 8.6 DIAGRAM: 35 complement(1875820..1878459) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.38e-02 E-VALUE = 8.6 DIAGRAM: 35 complement(1903948..1904247) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.38e-02 E-VALUE = 8.6 DIAGRAM: 35 complement(1187140..1187745) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.84e-02 E-VALUE = 9.7 DIAGRAM: 35 complement(1823172..1823963) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.84e-02 E-VALUE = 9.7 DIAGRAM: 35 complement(1849907..1850932) NC_014222 Methanococcus voltae A3 chromosome, complete genome. LENGTH = 35 COMBINED P-VALUE = 3.84e-02 E-VALUE = 9.7 DIAGRAM: 35 ******************************************************************************** CPU: meme-worker-0 Time 0.088000 secs. mast meme.xml NC_014222.fasta -oc . -nostatus