BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= embl|K02129|K02129 E. coli metK gene coding for S-adenosylmethionine synthetase. ... (1462 letters) Database: 3 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008842 AE006468 |AE008842| Salmonella typhimurium LT2, section... 1009 0.0 embl|AE006143|AE006143 Pasteurella multocida subsp. multocida st... 121 5e-27 AE012176 AE008922 |AE012176| Xanthomonas campestris pv. campestr... 76 3e-13 AE012255 AE008922 |AE012255| Xanthomonas campestris pv. campestr... 36 0.23 AE012436 AE008922 |AE012436| Xanthomonas campestris pv. campestr... 34 0.90 AE012229 AE008922 |AE012229| Xanthomonas campestris pv. campestr... 34 0.90 AE012129 AE008922 |AE012129| Xanthomonas campestris pv. campestr... 34 0.90 embl|AE006198|AE006198 Pasteurella multocida subsp. multocida st... 32 3.6 AE012547 AE008922 |AE012547| Xanthomonas campestris pv. campestr... 32 3.6 AE012537 AE008922 |AE012537| Xanthomonas campestris pv. campestr... 32 3.6 AE012512 AE008922 |AE012512| Xanthomonas campestris pv. campestr... 32 3.6 AE012474 AE008922 |AE012474| Xanthomonas campestris pv. campestr... 32 3.6 AE012449 AE008922 |AE012449| Xanthomonas campestris pv. campestr... 32 3.6 AE012388 AE008922 |AE012388| Xanthomonas campestris pv. campestr... 32 3.6 AE012383 AE008922 |AE012383| Xanthomonas campestris pv. campestr... 32 3.6 AE012363 AE008922 |AE012363| Xanthomonas campestris pv. campestr... 32 3.6 AE012339 AE008922 |AE012339| Xanthomonas campestris pv. campestr... 32 3.6 AE012221 AE008922 |AE012221| Xanthomonas campestris pv. campestr... 32 3.6 AE012152 AE008922 |AE012152| Xanthomonas campestris pv. campestr... 32 3.6 AE008862 AE006468 |AE008862| Salmonella typhimurium LT2, section... 32 3.6 AE008844 AE006468 |AE008844| Salmonella typhimurium LT2, section... 32 3.6 AE008810 AE006468 |AE008810| Salmonella typhimurium LT2, section... 32 3.6 AE008772 AE006468 |AE008772| Salmonella typhimurium LT2, section... 32 3.6 AE008730 AE006468 |AE008730| Salmonella typhimurium LT2, section... 32 3.6 AE008712 AE006468 |AE008712| Salmonella typhimurium LT2, section... 32 3.6 >AE008842 AE006468 |AE008842| Salmonella typhimurium LT2, section 146 of 220 of the complete genome. Length = 22204 Score = 1009 bits (509), Expect = 0.0 Identities = 1039/1208 (86%), Gaps = 12/1208 (0%) Strand = Plus / Plus Query: 41 cacaacagtttgagctaaccaaattctctttaggtgatattaaatatggcaaaacacctt 100 ||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||| Sbjct: 5207 cacaacagtttgagctaactaaattctccttaggtgaaattaaatatggcaaaacacctt 5266 Query: 101 tttacgtccgagtccgtctctgagggccatcctgacaaaattgctgaccaaatttctgat 160 |||||||| |||||||| || || || |||||||||||||| || |||||||| |||||| Sbjct: 5267 tttacgtctgagtccgtatcagaagggcatcctgacaaaatcgcagaccaaatctctgat 5326 Query: 161 gccgttttagacgcgatcctcgaacaggatccgaaagcacgcgttgcttgcgaaacctac 220 ||||| || ||||| ||||| |||||||||||||||||||||| || || ||||||||| Sbjct: 5327 gccgtgttggacgctatcctgcaacaggatccgaaagcacgcgtcgcctgtgaaacctac 5386 Query: 221 gtaaaaaccggcattggttttagttggcggcgaaatcaccaccagcgaccttgggtagac 280 || |||||||||| |||||||||||||||| || ||||||||||||| | ||||| || Sbjct: 5387 gttaaaaccggca-tggttttagttggcggtgagatcaccaccagcg--cctgggtcgat 5443 Query: 281 atcgaagagatcacccgtaacaccgttcgcgaaattggctatgtgcattccgacatgggc 340 ||||||||||| |||||||| || || ||||||||||||||||||||||||||||||||| Sbjct: 5444 atcgaagagattacccgtaatacggtgcgcgaaattggctatgtgcattccgacatgggc 5503 Query: 341 tttgacgctaactcctgtgcggttctgagcgctatcggcaaacagtctcctgacatcaac 400 |||||||| ||||| || ||||| |||||||| || |||||||||||||| || |||||| Sbjct: 5504 tttgacgccaactcttgcgcggtactgagcgcaattggcaaacagtctccggatatcaac 5563 Query: 401 cagggcgttgaccgtgccgatccgctggaacagggcgcgggtgaccagggtcttgatgtt 460 |||||||||||||| || || ||||||||||| |||||||| |||||||| | ||||||| Sbjct: 5564 cagggcgttgaccgcgcagacccgctggaacaaggcgcgggcgaccaggg-cctgatgtt 5622 Query: 461 tcggctacgcaactaatgaaaccgacgtgcctgatgccagcacctatcacctatgcccac 520 | |||||||| || |||||||||||||| |||||||| || || |||||||| || ||| Sbjct: 5623 t-ggctacgcgacaaatgaaaccgacgt-actgatgcctgcgccaatcacctacgcgcac 5680 Query: 521 cgtctggtacagcgtcaggctgaagtgcgtaaaaacggcactctgc---gtgtgcgcccg 577 ||||||||||||||||||||||||||||||||||| ||||| |||| | |||| ||| Sbjct: 5681 cgtctggtacagcgtcaggctgaagtgcgtaaaaatggcaccctgccatggttgcgtccg 5740 Query: 578 gacgcgaaaagccaggtgacttttagctatgacgacggcaaaatcgttggtatcgatgct 637 || || ||||||||||| ||||| |||||||||||||||||||| |||||||| || Sbjct: 5741 gatgcaaaaagccaggtcactttccagtatgacgacggcaaaatcgtcggtatcgacgcc 5800 Query: 638 gtcgtgctttccactcagcactctgaagagatcgaccagaaatcgctgcaagaagcggta 697 || || || || || |||||| | ||||| |||||||| |||||||||||||||||||| Sbjct: 5801 gtggttctctctacgcagcacgcagaagatatcgaccaaaaatcgctgcaagaagcggtg 5860 Query: 698 atggaagagatcatcaagccaattctgcccgctgaatggctgacttctgccaccaaattc 757 ||||||||||||||||| || |||||||| |||||||| | | | | |||| || || Sbjct: 5861 atggaagagatcatcaaacccattctgccgtctgaatggttaaatacgtccactaagttt 5920 Query: 758 ttcatcaacccgaccggtcgtttcgttatcggtggcccaatgggtgactgcggtcttact 817 || |||||||| ||||| ||||| |||||||| ||||| ||||| || |||||||| || Sbjct: 5921 tttatcaacccaaccgggcgttttgttatcggcggcccgatgggcgattgcggtctgacc 5980 Query: 818 ggtcgtaaaattatcgttgatactaccggcggcatggcgcgtcacggtggcggtgcattc 877 |||||||| || ||||||||||| |||||| |||||||||||||| ||||| || ||| Sbjct: 5981 ggtcgtaagatcatcgttgatacctacggcggtatggcgcgtcacggcggcggcgccttc 6040 Query: 878 tctggtaaagatccatcaaaagtggaccgttccgcagcctacgcagcacgttatgtcgcg 937 || ||||||||||| || ||||| |||||||| ||||| ||||| || |||||||||||| Sbjct: 6041 tccggtaaagatccgtctaaagttgaccgttctgcagcttacgctgcgcgttatgtcgcg 6100 Query: 938 aaaaacatcgttgctgctggcctggccgatcgttgtgaaattcaggtttcctacgcaatc 997 ||||||||||| || || || ||||| ||||| |||||||| ||||| |||||||| ||| Sbjct: 6101 aaaaacatcgtggcggcaggtctggcggatcgctgtgaaatccaggtctcctacgctatc 6160 Query: 998 ggcctggctgaaccgacctccatcatggtagaaactttcggtactgagaaagtgccttct 1057 ||| | || || ||||| ||||||||||| ||||| ||||||||||| ||||||||| || Sbjct: 6161 ggcgtagcggagccgacgtccatcatggtggaaacgttcggtactgaaaaagtgcctgct 6220 Query: 1058 gaacaactgaccctgctggtacgtgagttcttcgacctg---ccaatcggtctgattcag 1114 ||||| ||| |||||||| || || |||||||||||| || ||| |||||||| Sbjct: 6221 gaacagttgattctgctggtgcgcgaattcttcgacctgcgcccgtacggcttgattcag 6280 Query: 1115 atgctggatctgctgcacccgatctacaaagaaaccgcagcatacggtcactttggtcgt 1174 ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| Sbjct: 6281 atgctggatctgctgcacccgatctacaaagaaactgcggcttacggccacttcggtcgc 6340 Query: 1175 gaacatttcccgtgggaaaaaaccgacaaagcgcagctgctgcgcgatgctgccggtctg 1234 ||| | ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 6341 gaaaacttcccatgggaaaaaaccgacaaagcgcaactgctgcgcgatgctgccggtctg 6400 Query: 1235 aagtaatc 1242 || ||||| Sbjct: 6401 aaataatc 6408 >embl|AE006143|AE006143 Pasteurella multocida subsp. multocida str. Pm70 section 110 of 204 of the complete genome. Length = 10578 Score = 121 bits (61), Expect = 5e-27 Identities = 235/293 (80%) Strand = Plus / Minus Query: 749 accaaattcttcatcaacccgaccggtcgtttcgttatcggtggcccaatgggtgactgc 808 ||||||| ||||||||||| || || || || || || ||||| || |||||||||||| Sbjct: 6795 accaaatatttcatcaacccaacaggacgctttgtgattggtggtccgatgggtgactgc 6736 Query: 809 ggtcttactggtcgtaaaattatcgttgatactaccggcggcatggcgcgtcacggtggc 868 || | || || ||||||||||| || |||||| |||||| |||||||| |||||| Sbjct: 6735 gggttaacagggcgtaaaattattgtggatacttacggcggtgccgcgcgtcatggtggc 6676 Query: 869 ggtgcattctctggtaaagatccatcaaaagtggaccgttccgcagcctacgcagcacgt 928 ||||||||||| ||||||||||| || ||||| ||||| || || || || || || ||| Sbjct: 6675 ggtgcattctcgggtaaagatccttccaaagtagaccgctcagctgcttatgcggcgcgt 6616 Query: 929 tatgtcgcgaaaaacatcgttgctgctggcctggccgatcgttgtgaaattcaggtttcc 988 ||||| |||||||| || |||||||| || || || |||||||| |||||||| |||| Sbjct: 6615 tatgtggcgaaaaatattgttgctgcggggcttgcagatcgttgcgaaattcaactttcg 6556 Query: 989 tacgcaatcggcctggctgaaccgacctccatcatggtagaaactttcggtac 1041 || || || || | ||||| ||||| || |||||||| |||||||| ||||| Sbjct: 6555 tatgcgattggggttgctgatccgacgtctatcatggtggaaacttttggtac 6503 Score = 60.0 bits (30), Expect = 2e-08 Identities = 99/122 (81%) Strand = Plus / Minus Query: 107 tccgagtccgtctctgagggccatcctgacaaaattgctgaccaaatttctgatgccgtt 166 ||||| ||||| || || || ||||| || |||||||| || |||||||| ||||| || Sbjct: 7434 tccgaatccgtatcagaaggacatccagataaaattgccgatcaaatttccgatgcggta 7375 Query: 167 ttagacgcgatcctcgaacaggatccgaaagcacgcgttgcttgcgaaacctacgtaaaa 226 ||||||| || | |||| ||||| ||||| ||||||||||| |||||||| |||||| Sbjct: 7374 ttagacgaaattttaaaacaagatcccaaagcccgcgttgcttgtgaaacctatgtaaaa 7315 Query: 227 ac 228 || Sbjct: 7314 ac 7313 Score = 48.1 bits (24), Expect = 6e-05 Identities = 33/36 (91%) Strand = Plus / Minus Query: 1160 ggtcactttggtcgtgaacatttcccgtgggaaaaa 1195 ||||||||||| |||||||| ||||| ||||||||| Sbjct: 6381 ggtcactttgggcgtgaacaattcccatgggaaaaa 6346 >AE012176 AE008922 |AE012176| Xanthomonas campestris pv. campestris str. ATCC 33913, section 84 of 460 of the complete genome. Length = 12556 Score = 75.8 bits (38), Expect = 3e-13 Identities = 131/162 (80%) Strand = Plus / Minus Query: 844 cggcggcatggcgcgtcacggtggcggtgcattctctggtaaagatccatcaaaagtgga 903 ||||||| ||| |||||||| ||||| || ||||| || || ||||| || || || || Sbjct: 962 cggcggctgggcccgtcacggcggcggcgcgttctcgggcaaggatccgtccaaggtcga 903 Query: 904 ccgttccgcagcctacgcagcacgttatgtcgcgaaaaacatcgttgctgctggcctggc 963 |||||| |||||||| || || || ||||| || || ||| |||| || || |||||||| Sbjct: 902 ccgttcggcagcctatgcggcgcgctatgtggccaagaacgtcgtggcggccggcctggc 843 Query: 964 cgatcgttgtgaaattcaggtttcctacgcaatcggcctggc 1005 ||| ||||| ||| | |||||||||||||| |||||| |||| Sbjct: 842 cgaccgttgcgaagtgcaggtttcctacgccatcggcgtggc 801 Score = 50.1 bits (25), Expect = 2e-05 Identities = 37/41 (90%) Strand = Plus / Minus Query: 374 atcggcaaacagtctcctgacatcaaccagggcgttgaccg 414 |||||||| ||||| || ||||||||||||||||| ||||| Sbjct: 1438 atcggcaagcagtccccggacatcaaccagggcgtggaccg 1398 >AE012255 AE008922 |AE012255| Xanthomonas campestris pv. campestris str. ATCC 33913, section 163 of 460 of the complete genome. Length = 12201 Score = 36.2 bits (18), Expect = 0.23 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1213 gctgcgcgatgctgccgg 1230 |||||||||||||||||| Sbjct: 11582 gctgcgcgatgctgccgg 11565 >AE012436 AE008922 |AE012436| Xanthomonas campestris pv. campestris str. ATCC 33913, section 344 of 460 of the complete genome. Length = 11689 Score = 34.2 bits (17), Expect = 0.90 Identities = 17/17 (100%) Strand = Plus / Minus Query: 423 cgctggaacagggcgcg 439 ||||||||||||||||| Sbjct: 939 cgctggaacagggcgcg 923 >AE012229 AE008922 |AE012229| Xanthomonas campestris pv. campestris str. ATCC 33913, section 137 of 460 of the complete genome. Length = 10029 Score = 34.2 bits (17), Expect = 0.90 Identities = 17/17 (100%) Strand = Plus / Minus Query: 1205 gcgcagctgctgcgcga 1221 ||||||||||||||||| Sbjct: 8160 gcgcagctgctgcgcga 8144 >AE012129 AE008922 |AE012129| Xanthomonas campestris pv. campestris str. ATCC 33913, section 37 of 460 of the complete genome. Length = 10029 Score = 34.2 bits (17), Expect = 0.90 Identities = 17/17 (100%) Strand = Plus / Minus Query: 1214 ctgcgcgatgctgccgg 1230 ||||||||||||||||| Sbjct: 1800 ctgcgcgatgctgccgg 1784 >embl|AE006198|AE006198 Pasteurella multocida subsp. multocida str. Pm70 section 165 of 204 of the complete genome. Length = 12956 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 446 cagggtcttgatgttt 461 |||||||||||||||| Sbjct: 1550 cagggtcttgatgttt 1565 >AE012547 AE008922 |AE012547| Xanthomonas campestris pv. campestris str. ATCC 33913, section 455 of 460 of the complete genome. Length = 10126 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 843 ccggcggcatggcgcg 858 |||||||||||||||| Sbjct: 8932 ccggcggcatggcgcg 8947 >AE012537 AE008922 |AE012537| Xanthomonas campestris pv. campestris str. ATCC 33913, section 445 of 460 of the complete genome. Length = 11952 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 603 gctatgacgacggcaa 618 |||||||||||||||| Sbjct: 9155 gctatgacgacggcaa 9140 >AE012512 AE008922 |AE012512| Xanthomonas campestris pv. campestris str. ATCC 33913, section 420 of 460 of the complete genome. Length = 11141 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 992 gcaatcggcctggctg 1007 |||||||||||||||| Sbjct: 3774 gcaatcggcctggctg 3789 >AE012474 AE008922 |AE012474| Xanthomonas campestris pv. campestris str. ATCC 33913, section 382 of 460 of the complete genome. Length = 10995 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 858 gtcacggtggcggtgc 873 |||||||||||||||| Sbjct: 3898 gtcacggtggcggtgc 3883 >AE012449 AE008922 |AE012449| Xanthomonas campestris pv. campestris str. ATCC 33913, section 357 of 460 of the complete genome. Length = 11450 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 951 ctgctggcctggccga 966 |||||||||||||||| Sbjct: 8826 ctgctggcctggccga 8811 >AE012388 AE008922 |AE012388| Xanthomonas campestris pv. campestris str. ATCC 33913, section 296 of 460 of the complete genome. Length = 10043 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 245 tggcggcgaaatcacc 260 |||||||||||||||| Sbjct: 5338 tggcggcgaaatcacc 5353 >AE012383 AE008922 |AE012383| Xanthomonas campestris pv. campestris str. ATCC 33913, section 291 of 460 of the complete genome. Length = 10211 Score = 32.2 bits (16), Expect = 3.6 Identities = 19/20 (95%) Strand = Plus / Plus Query: 949 tgctgctggcctggccgatc 968 |||||||||||||| ||||| Sbjct: 144 tgctgctggcctggtcgatc 163 >AE012363 AE008922 |AE012363| Xanthomonas campestris pv. campestris str. ATCC 33913, section 271 of 460 of the complete genome. Length = 8145 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 525 tggtacagcgtcaggc 540 |||||||||||||||| Sbjct: 5442 tggtacagcgtcaggc 5457 >AE012339 AE008922 |AE012339| Xanthomonas campestris pv. campestris str. ATCC 33913, section 247 of 460 of the complete genome. Length = 10365 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 406 cgttgaccgtgccgat 421 |||||||||||||||| Sbjct: 7973 cgttgaccgtgccgat 7988 >AE012221 AE008922 |AE012221| Xanthomonas campestris pv. campestris str. ATCC 33913, section 129 of 460 of the complete genome. Length = 12792 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1207 gcagctgctgcgcgat 1222 |||||||||||||||| Sbjct: 1340 gcagctgctgcgcgat 1325 >AE012152 AE008922 |AE012152| Xanthomonas campestris pv. campestris str. ATCC 33913, section 60 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 951 ctgctggcctggccga 966 |||||||||||||||| Sbjct: 3558 ctgctggcctggccga 3573 >AE008862 AE006468 |AE008862| Salmonella typhimurium LT2, section 166 of 220 of the complete genome. Length = 22307 Score = 32.2 bits (16), Expect = 3.6 Identities = 19/20 (95%) Strand = Plus / Minus Query: 400 ccagggcgttgaccgtgccg 419 |||||||||||| ||||||| Sbjct: 18511 ccagggcgttgatcgtgccg 18492 >AE008844 AE006468 |AE008844| Salmonella typhimurium LT2, section 148 of 220 of the complete genome. Length = 25034 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 606 atgacgacggcaaaat 621 |||||||||||||||| Sbjct: 2332 atgacgacggcaaaat 2317 >AE008810 AE006468 |AE008810| Salmonella typhimurium LT2, section 114 of 220 of the complete genome. Length = 23636 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Minus Query: 415 tgccgatccgctggaa 430 |||||||||||||||| Sbjct: 5173 tgccgatccgctggaa 5158 >AE008772 AE006468 |AE008772| Salmonella typhimurium LT2, section 76 of 220 of the complete genome. Length = 20609 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 71 taggtgatattaaata 86 |||||||||||||||| Sbjct: 9204 taggtgatattaaata 9219 >AE008730 AE006468 |AE008730| Salmonella typhimurium LT2, section 38 of 220 of the complete genome. Length = 20941 Score = 32.2 bits (16), Expect = 3.6 Identities = 19/20 (95%) Strand = Plus / Minus Query: 248 cggcgaaatcaccaccagcg 267 |||||| ||||||||||||| Sbjct: 6265 cggcgacatcaccaccagcg 6246 >AE008712 AE006468 |AE008712| Salmonella typhimurium LT2, section 20 of 220 of the complete genome. Length = 21521 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1159 cggtcactttggtcgt 1174 |||||||||||||||| Sbjct: 14723 cggtcactttggtcgt 14738 Database: 3 Posted date: Nov 1, 2008 10:34 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 195,896 Number of extensions: 11800 Number of successful extensions: 107 Number of sequences better than 10.0: 25 Number of HSP's gapped: 101 Number of HSP's successfully gapped: 31 Length of query: 1462 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 1445 Effective length of database: 12,228,859 Effective search space: 17670701255 Effective search space used: 17670701255 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 16 (32.2 bits)