BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= ECBTUB M10112.1 E.coli btuB gene for the vitamin B12 receptor protein BtuB. (1845 letters) Database: 3g 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008893 AE006468 |AE008893| Salmonella typhimurium LT2, section... 258 4e-68 AE008826 AE006468 |AE008826| Salmonella typhimurium LT2, section... 46 3e-04 AE012350 AE008922 |AE012350| Xanthomonas campestris pv. campestr... 46 3e-04 AE008794 AE006468 |AE008794| Salmonella typhimurium LT2, section... 36 0.29 AE012232 AE008922 |AE012232| Xanthomonas campestris pv. campestr... 36 0.29 AE012399 AE008922 |AE012399| Xanthomonas campestris pv. campestr... 34 1.1 AE012329 AE008922 |AE012329| Xanthomonas campestris pv. campestr... 34 1.1 embl|AE006220|AE006220 Pasteurella multocida subsp. multocida st... 32 4.5 embl|AE006205|AE006205 Pasteurella multocida subsp. multocida st... 32 4.5 embl|AE006123|AE006123 Pasteurella multocida subsp. multocida st... 32 4.5 embl|AE006118|AE006118 Pasteurella multocida subsp. multocida st... 32 4.5 AE008916 AE006468 |AE008916| Salmonella typhimurium LT2, section... 32 4.5 AE008842 AE006468 |AE008842| Salmonella typhimurium LT2, section... 32 4.5 AE008822 AE006468 |AE008822| Salmonella typhimurium LT2, section... 32 4.5 AE008753 AE006468 |AE008753| Salmonella typhimurium LT2, section... 32 4.5 AE008750 AE006468 |AE008750| Salmonella typhimurium LT2, section... 32 4.5 AE008746 AE006468 |AE008746| Salmonella typhimurium LT2, section... 32 4.5 AE008734 AE006468 |AE008734| Salmonella typhimurium LT2, section... 32 4.5 AE008714 AE006468 |AE008714| Salmonella typhimurium LT2, section... 32 4.5 AE012519 AE008922 |AE012519| Xanthomonas campestris pv. campestr... 32 4.5 AE012471 AE008922 |AE012471| Xanthomonas campestris pv. campestr... 32 4.5 AE012336 AE008922 |AE012336| Xanthomonas campestris pv. campestr... 32 4.5 AE012238 AE008922 |AE012238| Xanthomonas campestris pv. campestr... 32 4.5 AE012219 AE008922 |AE012219| Xanthomonas campestris pv. campestr... 32 4.5 AE012103 AE008922 |AE012103| Xanthomonas campestris pv. campestr... 32 4.5 >AE008893 AE006468 |AE008893| Salmonella typhimurium LT2, section 197 of 220 of the complete genome. Length = 20178 Score = 258 bits (130), Expect = 4e-68 Identities = 340/410 (82%) Strand = Plus / Plus Query: 1132 cgcagtgacgataactcacagtttggtcgtcatggaacctggcaaaccagcgccggttgg 1191 |||||||| || ||||| ||||||||||||||||| || |||||||||||||| || ||| Sbjct: 6370 cgcagtgatgacaactcccagtttggtcgtcatggtacatggcaaaccagcgcgggatgg 6429 Query: 1192 gaattcatcgaaggttatcgcttcattgcttcctacgggacatcttataaggcaccaaat 1251 || || || |||||||||||||| ||||| |||||||| || || || || || || ||| Sbjct: 6430 gagtttatagaaggttatcgctttattgcctcctacggaacctcctacaaagcgcctaat 6489 Query: 1252 ctggggcaactgtatggcttctacggaaatccgaatctggacccggagaaaagcaaacag 1311 |||| ||||||||||| | ||||| |||||||| ||| | || || || || |||||| Sbjct: 6490 ttgggccaactgtatggttattacggtaatccgaacctgaatcctgaaaagagtaaacag 6549 Query: 1312 tgggaaggcgcgtttgaaggcttaaccgctggggtgaactggcgtatttccggatatcgt 1371 ||||||||||| |||||||| |||||||||| || | |||||||||||| || |||||| Sbjct: 6550 tgggaaggcgcatttgaagggctaaccgctggcgtcagctggcgtatttcaggttatcgt 6609 Query: 1372 aacgatgtcagtgacttgatcgattatgatgatcacaccctgaaatattacaacgaaggg 1431 |||||| | | |||| ||||||||||||| ||||| | ||||||||||||||||| Sbjct: 6610 aacgatattaatgacatgatcgattatgacgatcatctgcaaaaatattacaacgaaggt 6669 Query: 1432 aaagcgcggattaagggcgtcgaggcgaccgccaattttgataccggaccactgacgcat 1491 || ||||| ||||| || | |||||||| || ||||| ||||||||||| | |||||| Sbjct: 6670 aaggcgcgcattaaaggtattgaggcgacggcgaatttcgataccggaccgttaacgcat 6729 Query: 1492 actgtgagttatgattatgtcgatgcgcgcaatgcgattaccgacacgcc 1541 || || ||||||||||| || |||||||| |||||||||||||| ||||| Sbjct: 6730 acggtcagttatgattacgttgatgcgcgtaatgcgattaccgatacgcc 6779 Score = 246 bits (124), Expect = 2e-64 Identities = 157/168 (93%) Strand = Plus / Plus Query: 1678 aaaatgggcggtgtgagcttgtgggatcttgcggttgcgtatccggtcacctctcacctg 1737 ||||||||||| || || || ||||||||| ||||||| |||||||||||||| || ||| Sbjct: 6916 aaaatgggcggcgtcagtttatgggatcttacggttgcatatccggtcacctcacatctg 6975 Query: 1738 acagttcgtggtaaaatagccaacctgttcgacaaagattatgagacagtctatggctac 1797 ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct: 6976 acagttcgtggtaaaatagccaacctgttcgacaaagattacgagacagtttatggctac 7035 Query: 1798 caaactgcaggacgggaatacaccttgtctggcagctacaccttctga 1845 |||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 7036 caaactgcaggacgagaatacaccttgtctggcagctacaccttctga 7083 Score = 206 bits (104), Expect = 1e-52 Identities = 347/428 (81%) Strand = Plus / Plus Query: 649 tttttaagtaaaacgctttatggcgcgctggagcataactttactgatgcctggagcggc 708 ||||| ||||||||||||||||||||| | ||||||| |||| ||||| ||||||||| Sbjct: 5887 tttttgagtaaaacgctttatggcgcgttagagcataccttttctgatcgctggagcgga 5946 Query: 709 tttgtgcgcggctatggctatgataaccgtaccaattatgacgcgtattattctcccggt 768 || ||||| || |||||||| |||||||||||| |||| ||||| ||||| || || || Sbjct: 5947 ttcgtgcgtggttatggctacgataaccgtaccgattacgacgcctattactcgccgggc 6006 Query: 769 tcaccgttgctcgatacccgtaaactctatagccaaagttgggacgccgggctgcgctat 828 || ||| || | ||||| || ||||| ||||||||||| |||||||||||||||| || | Sbjct: 6007 tcgccgctgattgatacacgcaaactttatagccaaagctgggacgccgggctgcacttt 6066 Query: 829 aacggcgaactgattaaatcacaactcattaccagctatagccatagcaaagattacaac 888 || ||||||| ||| | || || || || | ||||||||||| || |||||||||||| Sbjct: 6067 aatggcgaacgtattcagtctcagctggtttcaagctatagccacagtaaagattacaac 6126 Query: 889 tacgatccccattatggtcgttatgattcgtcggcgacgctcgatgagatgaagcaatac 948 || ||||| || ||||| || |||||| | || || ||||| ||||||||||| || ||| Sbjct: 6127 tatgatccgcactatggccggtatgatacctccgccacgctggatgagatgaaacagtac 6186 Query: 949 accgtccagtgggcaaacaatgtcatcgttggtcacggtagtattggtgcgggtgtcgac 1008 | || || ||| | |||| ||| |||| || ||||||| | |||| ||||| || ||| Sbjct: 6187 aatgttcaatggaccaacagtgtggtcgtggggcacggtaatgttggggcgggcgtagac 6246 Query: 1009 tggcagaaacagactacgacgccgggtacaggttatgttgaggatggatatgatcaacgt 1068 ||||||||||||||||| ||||| ||||| || ||||| || |||||||| || ||| Sbjct: 6247 tggcagaaacagactaccacgccaggtaccggctatgtgcccgagggatatgaccagcgt 6306 Query: 1069 aataccgg 1076 |||||||| Sbjct: 6307 aataccgg 6314 Score = 202 bits (102), Expect = 2e-51 Identities = 372/462 (80%) Strand = Plus / Plus Query: 1 atgattaaaaaagcttccctgctgacggcgtgttccgtcacggcattttccgcttgggca 60 ||||||||||||||| | ||||||||||||| ||||||||||| |||||||||||||| Sbjct: 5239 atgattaaaaaagctacgctgctgacggcgttctccgtcacggccttttccgcttgggcg 5298 Query: 61 caggataccagcccggatactctcgtcgttactgctaaccgttttgaacagccgcgcagc 120 ||||| || ||||||||||| || || || || || ||||||||| | |||||||||||| Sbjct: 5299 caggacactagcccggataccctggttgtcaccgccaaccgttttcagcagccgcgcagc 5358 Query: 121 actgtgcttgcaccaaccaccgttgtgacccgtcaggatatcgaccgctggcagtcgacc 180 | || || || || ||| | ||||| ||||||||||| || |||||||| |||||| Sbjct: 5359 gcggttctggcgcccgttaccatcgtgacgcgtcaggatattgaacgctggcaatcgacc 5418 Query: 181 tcggtcaatgatgtgctgcgccgtcttccgggcgtcgatatcacccaaaacggcggttca 240 || || |||||||| ||||||||| | || ||||||||||| | || | |||||| | Sbjct: 5419 tccgtaaatgatgttctgcgccgtttgcctggcgtcgatattgcgcagagcggcggcgcc 5478 Query: 241 ggtcagctctcatctatttttattcgcggtacaaatgccagtcatgtgttggtgttaatt 300 || || ||| || ||||| |||||||| || || |||| ||||| |||| || ||| Sbjct: 5479 ggacaaaactcctccattttcattcgcggcaccaactccagccatgtactggtattgatt 5538 Query: 301 gatggcgtacgcctgaatctggcgggggtgagtggttctgccgaccttagccagttccct 360 || ||||| || |||||| | || || ||||| || || ||||| || ||||||||||| Sbjct: 5539 gacggcgtgcgtctgaatttagcaggcgtgagcgggtccgccgatctcagccagttcccg 5598 Query: 361 attgcgcttgtccagcgtgttgaatatatccgtgggccgcgctccgctgtttatggttcc 420 | |||| || ||||| |||||||||| || || |||||||||||| ||||||||||| Sbjct: 5599 gtgtcgctggtacagcgcattgaatatattcgcggtccgcgctccgctatttatggttcc 5658 Query: 421 gatgcaataggcggggtggtgaatatcatcacgacgcgcgat 462 ||||| || ||||| || ||||||||||| |||||||||||| Sbjct: 5659 gatgctatcggcggcgtagtgaatatcattacgacgcgcgat 5700 >AE008826 AE006468 |AE008826| Salmonella typhimurium LT2, section 130 of 220 of the complete genome. Length = 20513 Score = 46.1 bits (23), Expect = 3e-04 Identities = 23/23 (100%) Strand = Plus / Minus Query: 430 ggcggggtggtgaatatcatcac 452 ||||||||||||||||||||||| Sbjct: 19052 ggcggggtggtgaatatcatcac 19030 >AE012350 AE008922 |AE012350| Xanthomonas campestris pv. campestris str. ATCC 33913, section 258 of 460 of the complete genome. Length = 12191 Score = 46.1 bits (23), Expect = 3e-04 Identities = 35/39 (89%) Strand = Plus / Minus Query: 412 tatggttccgatgcaataggcggggtggtgaatatcatc 450 ||||| |||||||| || ||||||||||| ||||||||| Sbjct: 8585 tatggctccgatgcgattggcggggtggtcaatatcatc 8547 >AE008794 AE006468 |AE008794| Salmonella typhimurium LT2, section 98 of 220 of the complete genome. Length = 26591 Score = 36.2 bits (18), Expect = 0.29 Identities = 21/22 (95%) Strand = Plus / Minus Query: 185 tcaatgatgtgctgcgccgtct 206 |||||||| ||||||||||||| Sbjct: 21698 tcaatgatttgctgcgccgtct 21677 >AE012232 AE008922 |AE012232| Xanthomonas campestris pv. campestris str. ATCC 33913, section 140 of 460 of the complete genome. Length = 10215 Score = 36.2 bits (18), Expect = 0.29 Identities = 18/18 (100%) Strand = Plus / Plus Query: 690 tactgatgcctggagcgg 707 |||||||||||||||||| Sbjct: 10150 tactgatgcctggagcgg 10167 >AE012399 AE008922 |AE012399| Xanthomonas campestris pv. campestris str. ATCC 33913, section 307 of 460 of the complete genome. Length = 12752 Score = 34.2 bits (17), Expect = 1.1 Identities = 17/17 (100%) Strand = Plus / Plus Query: 436 gtggtgaatatcatcac 452 ||||||||||||||||| Sbjct: 10381 gtggtgaatatcatcac 10397 >AE012329 AE008922 |AE012329| Xanthomonas campestris pv. campestris str. ATCC 33913, section 237 of 460 of the complete genome. Length = 11212 Score = 34.2 bits (17), Expect = 1.1 Identities = 17/17 (100%) Strand = Plus / Minus Query: 1511 tcgatgcgcgcaatgcg 1527 ||||||||||||||||| Sbjct: 8510 tcgatgcgcgcaatgcg 8494 >embl|AE006220|AE006220 Pasteurella multocida subsp. multocida str. Pm70 section 187 of 204 of the complete genome. Length = 13709 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 289 ttggtgttaattgatg 304 |||||||||||||||| Sbjct: 11896 ttggtgttaattgatg 11911 >embl|AE006205|AE006205 Pasteurella multocida subsp. multocida str. Pm70 section 172 of 204 of the complete genome. Length = 10552 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1301 aaagcaaacagtggga 1316 |||||||||||||||| Sbjct: 3081 aaagcaaacagtggga 3066 >embl|AE006123|AE006123 Pasteurella multocida subsp. multocida str. Pm70 section 90 of 204 of the complete genome. Length = 11950 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1426 gaagggaaagcgcgga 1441 |||||||||||||||| Sbjct: 10081 gaagggaaagcgcgga 10066 >embl|AE006118|AE006118 Pasteurella multocida subsp. multocida str. Pm70 section 85 of 204 of the complete genome. Length = 11828 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 367 cttgtccagcgtgttg 382 |||||||||||||||| Sbjct: 11285 cttgtccagcgtgttg 11270 >AE008916 AE006468 |AE008916| Salmonella typhimurium LT2, section 220 of 220 of the complete genome. Length = 13852 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1200 cgaaggttatcgcttc 1215 |||||||||||||||| Sbjct: 11826 cgaaggttatcgcttc 11811 >AE008842 AE006468 |AE008842| Salmonella typhimurium LT2, section 146 of 220 of the complete genome. Length = 22204 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 310 cgcctgaatctggcgg 325 |||||||||||||||| Sbjct: 16931 cgcctgaatctggcgg 16946 >AE008822 AE006468 |AE008822| Salmonella typhimurium LT2, section 126 of 220 of the complete genome. Length = 20889 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 1450 gtcgaggcgaccgcca 1465 |||||||||||||||| Sbjct: 3532 gtcgaggcgaccgcca 3517 >AE008753 AE006468 |AE008753| Salmonella typhimurium LT2, section 57 of 220 of the complete genome. Length = 22182 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 659 aaacgctttatggcgc 674 |||||||||||||||| Sbjct: 18162 aaacgctttatggcgc 18177 >AE008750 AE006468 |AE008750| Salmonella typhimurium LT2, section 54 of 220 of the complete genome. Length = 20396 Score = 32.2 bits (16), Expect = 4.5 Identities = 19/20 (95%) Strand = Plus / Plus Query: 1323 gtttgaaggcttaaccgctg 1342 |||||||| ||||||||||| Sbjct: 16657 gtttgaagccttaaccgctg 16676 >AE008746 AE006468 |AE008746| Salmonella typhimurium LT2, section 50 of 220 of the complete genome. Length = 22288 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 40 acggcattttccgctt 55 |||||||||||||||| Sbjct: 20882 acggcattttccgctt 20867 >AE008734 AE006468 |AE008734| Salmonella typhimurium LT2, section 42 of 220 of the complete genome. Length = 21522 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 447 catcacgacgcgcgat 462 |||||||||||||||| Sbjct: 17218 catcacgacgcgcgat 17203 >AE008714 AE006468 |AE008714| Salmonella typhimurium LT2, section 22 of 220 of the complete genome. Length = 20388 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1118 ttgaaggcgccagacg 1133 |||||||||||||||| Sbjct: 1526 ttgaaggcgccagacg 1541 >AE012519 AE008922 |AE012519| Xanthomonas campestris pv. campestris str. ATCC 33913, section 427 of 460 of the complete genome. Length = 11384 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1700 gggatcttgcggttgc 1715 |||||||||||||||| Sbjct: 3566 gggatcttgcggttgc 3581 >AE012471 AE008922 |AE012471| Xanthomonas campestris pv. campestris str. ATCC 33913, section 379 of 460 of the complete genome. Length = 10154 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 1757 ccaacctgttcgacaa 1772 |||||||||||||||| Sbjct: 8885 ccaacctgttcgacaa 8900 >AE012336 AE008922 |AE012336| Xanthomonas campestris pv. campestris str. ATCC 33913, section 244 of 460 of the complete genome. Length = 10286 Score = 32.2 bits (16), Expect = 4.5 Identities = 19/20 (95%) Strand = Plus / Minus Query: 1821 cttgtctggcagctacacct 1840 ||||||||||||| |||||| Sbjct: 6752 cttgtctggcagccacacct 6733 >AE012238 AE008922 |AE012238| Xanthomonas campestris pv. campestris str. ATCC 33913, section 146 of 460 of the complete genome. Length = 11884 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 775 ttgctcgatacccgta 790 |||||||||||||||| Sbjct: 9174 ttgctcgatacccgta 9189 >AE012219 AE008922 |AE012219| Xanthomonas campestris pv. campestris str. ATCC 33913, section 127 of 460 of the complete genome. Length = 11476 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 212 gcgtcgatatcaccca 227 |||||||||||||||| Sbjct: 8707 gcgtcgatatcaccca 8692 >AE012103 AE008922 |AE012103| Xanthomonas campestris pv. campestris str. ATCC 33913, section 11 of 460 of the complete genome. Length = 10696 Score = 32.2 bits (16), Expect = 4.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 364 gcgcttgtccagcgtg 379 |||||||||||||||| Sbjct: 7571 gcgcttgtccagcgtg 7586 Database: 3g Posted date: Nov 7, 2007 12:58 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 226,348 Number of extensions: 12183 Number of successful extensions: 76 Number of sequences better than 10.0: 25 Number of HSP's gapped: 73 Number of HSP's successfully gapped: 32 Length of query: 1845 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 1828 Effective length of database: 12,228,859 Effective search space: 22354354252 Effective search space used: 22354354252 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 16 (32.2 bits)