BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= X03038 X03038.1 E. coli adk gene for adenylate kinase (645 letters) Database: 3gen 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008718 AE006468 |AE008718| Salmonella typhimurium LT2, section... 613 e-175 AE008905 AE006468 |AE008905| Salmonella typhimurium LT2, section... 36 0.099 embl|AE006073|AE006073 Pasteurella multocida subsp. multocida st... 34 0.39 embl|AE006063|AE006063 Pasteurella multocida subsp. multocida st... 34 0.39 AE008861 AE006468 |AE008861| Salmonella typhimurium LT2, section... 34 0.39 AE008915 AE006468 |AE008915| Salmonella typhimurium LT2, section... 32 1.5 AE008808 AE006468 |AE008808| Salmonella typhimurium LT2, section... 32 1.5 AE008746 AE006468 |AE008746| Salmonella typhimurium LT2, section... 32 1.5 AE008735 AE006468 |AE008735| Salmonella typhimurium LT2, section... 32 1.5 AE012375 AE008922 |AE012375| Xanthomonas campestris pv. campestr... 32 1.5 AE012208 AE008922 |AE012208| Xanthomonas campestris pv. campestr... 32 1.5 embl|AE006111|AE006111 Pasteurella multocida subsp. multocida st... 30 6.1 embl|AE006109|AE006109 Pasteurella multocida subsp. multocida st... 30 6.1 embl|AE006104|AE006104 Pasteurella multocida subsp. multocida st... 30 6.1 embl|AE006066|AE006066 Pasteurella multocida subsp. multocida st... 30 6.1 AE008912 AE006468 |AE008912| Salmonella typhimurium LT2, section... 30 6.1 AE008858 AE006468 |AE008858| Salmonella typhimurium LT2, section... 30 6.1 AE008851 AE006468 |AE008851| Salmonella typhimurium LT2, section... 30 6.1 AE008850 AE006468 |AE008850| Salmonella typhimurium LT2, section... 30 6.1 AE008800 AE006468 |AE008800| Salmonella typhimurium LT2, section... 30 6.1 AE008794 AE006468 |AE008794| Salmonella typhimurium LT2, section... 30 6.1 AE008765 AE006468 |AE008765| Salmonella typhimurium LT2, section... 30 6.1 AE008724 AE006468 |AE008724| Salmonella typhimurium LT2, section... 30 6.1 AE012549 AE008922 |AE012549| Xanthomonas campestris pv. campestr... 30 6.1 AE012530 AE008922 |AE012530| Xanthomonas campestris pv. campestr... 30 6.1 AE012523 AE008922 |AE012523| Xanthomonas campestris pv. campestr... 30 6.1 AE012516 AE008922 |AE012516| Xanthomonas campestris pv. campestr... 30 6.1 AE012411 AE008922 |AE012411| Xanthomonas campestris pv. campestr... 30 6.1 AE012388 AE008922 |AE012388| Xanthomonas campestris pv. campestr... 30 6.1 AE012363 AE008922 |AE012363| Xanthomonas campestris pv. campestr... 30 6.1 AE012281 AE008922 |AE012281| Xanthomonas campestris pv. campestr... 30 6.1 AE012119 AE008922 |AE012119| Xanthomonas campestris pv. campestr... 30 6.1 AE012111 AE008922 |AE012111| Xanthomonas campestris pv. campestr... 30 6.1 AE012100 AE008922 |AE012100| Xanthomonas campestris pv. campestr... 30 6.1 AE012099 AE008922 |AE012099| Xanthomonas campestris pv. campestr... 30 6.1 >AE008718 AE006468 |AE008718| Salmonella typhimurium LT2, section 26 of 220 of the complete genome. Length = 20938 Score = 613 bits (309), Expect = e-175 Identities = 558/641 (87%) Strand = Plus / Plus Query: 1 atgcgtatcattctgcttggcgctccgggcgcggggaaagggactcaggctcagttcatc 60 |||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||| Sbjct: 11605 atgcgtattattctgcttggcgctccgggcgcgggtaaaggaactcaggctcagttcatc 11664 Query: 61 atggagaaatatggtattccgcaaatctccactggcgatatgctgcgtgctgcggtcaaa 120 ||||||||||||||||||||||||||||||||||||||||||||||| || || || ||| Sbjct: 11665 atggagaaatatggtattccgcaaatctccactggcgatatgctgcgcgccgcagtgaaa 11724 Query: 121 tctggctccgagctgggtaaacaagcaaaagacattatggatgctggcaaactggtcacc 180 || ||||||||| |||| ||||| || ||||| || ||||| || || |||||||| ||| Sbjct: 11725 tcaggctccgagttgggcaaacaggcgaaagatatcatggacgccggtaaactggtgacc 11784 Query: 181 gacgaactggtgatcgcgctggttaaagagcgcattgctcaggaagactgccgtaatggt 240 || ||||||||||| ||||||||||||||||| || || ||||||||||||||||| ||| Sbjct: 11785 gatgaactggtgattgcgctggttaaagagcgtatcgcccaggaagactgccgtaacggt 11844 Query: 241 ttcctgttggacggcttcccgcgtaccattccgcaggcagacgcgatgaaagaagcgggc 300 || ||| ||||||| |||||||| || || |||||||| |||||||||||||||||||| Sbjct: 11845 tttctgctggacggtttcccgcgcacgatcccgcaggctgacgcgatgaaagaagcgggt 11904 Query: 301 atcaatgttgattacgttctggaattcgacgtaccggacgaactgatcgttgaccgtatc 360 || || |||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 11905 attgtcgtggattacgtgctggaattcgacgtaccggacgaactgatcgttgaccgtatt 11964 Query: 361 gtcggtcgccgcgttcatgcgccgtctggtcgtgtttatcacgttaaattcaatccgccg 420 || ||||| ||||| || || | ||||| || ||||| |||||||| || ||||||||| Sbjct: 11965 gtgggtcgtcgcgtacacgccgcctctggccgcgtttaccacgttaagtttaatccgccg 12024 Query: 421 aaagtagaaggcaaagacgacgttaccggtgaagaactgactacccgtaaagatgatcag 480 ||||| ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| |||||| Sbjct: 12025 aaagtggaaggcaaagatgacgtcaccggcgaagatctgaccacccgtaaagacgatcag 12084 Query: 481 gaagagaccgtacgtaaacgtctggttgaataccatcagatgacagcaccgctgatcggc 540 ||||||||||| || ||||||||||| ||||| ||||||||||| || |||||||| ||| Sbjct: 12085 gaagagaccgttcgcaaacgtctggtggaatatcatcagatgaccgcgccgctgattggc 12144 Query: 541 tactactccaaagaagcagaagcgggtaataccaaatacgcgaaagttgacggcaccaag 600 |||||| |||||||| |||||||| || ||||||||||| ||||||||||| || || Sbjct: 12145 tactaccagaaagaagcggaagcgggcaacaccaaatacgctaaagttgacggtacgcag 12204 Query: 601 ccggttgctgaagttcgcgctgatctggaaaaaatcctcgg 641 | ||||| || || ||||| | ||||||||||||||||| Sbjct: 12205 gccgttgccgacgtgcgcgcagcgctggaaaaaatcctcgg 12245 >AE008905 AE006468 |AE008905| Salmonella typhimurium LT2, section 209 of 220 of the complete genome. Length = 23427 Score = 36.2 bits (18), Expect = 0.099 Identities = 18/18 (100%) Strand = Plus / Plus Query: 305 atgttgattacgttctgg 322 |||||||||||||||||| Sbjct: 3565 atgttgattacgttctgg 3582 >embl|AE006073|AE006073 Pasteurella multocida subsp. multocida str. Pm70 section 40 of 204 of the complete genome. Length = 14986 Score = 34.2 bits (17), Expect = 0.39 Identities = 20/21 (95%) Strand = Plus / Plus Query: 550 aaagaagcagaagcgggtaat 570 |||| |||||||||||||||| Sbjct: 1830 aaagcagcagaagcgggtaat 1850 >embl|AE006063|AE006063 Pasteurella multocida subsp. multocida str. Pm70 section 30 of 204 of the complete genome. Length = 10124 Score = 34.2 bits (17), Expect = 0.39 Identities = 68/85 (80%) Strand = Plus / Minus Query: 25 ccgggcgcggggaaagggactcaggctcagttcatcatggagaaatatggtattccgcaa 84 ||||| |||||||||||||| || || || || || ||| | |||| ||| ||||| ||| Sbjct: 5992 ccgggtgcggggaaagggacacaagcgcaatttattatgaataaatttggcattccacaa 5933 Query: 85 atctccactggcgatatgctgcgtg 109 || || || || |||||| |||||| Sbjct: 5932 atttcaacgggtgatatgttgcgtg 5908 Score = 30.2 bits (15), Expect = 6.1 Identities = 21/23 (91%) Strand = Plus / Minus Query: 421 aaagtagaaggcaaagacgacgt 443 ||||||||||| ||||| ||||| Sbjct: 5596 aaagtagaagggaaagatgacgt 5574 Score = 30.2 bits (15), Expect = 6.1 Identities = 21/23 (91%) Strand = Plus / Minus Query: 250 gacggcttcccgcgtaccattcc 272 ||||||||||| || |||||||| Sbjct: 5767 gacggcttcccacgcaccattcc 5745 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 136 ggtaaacaagcaaaa 150 ||||||||||||||| Sbjct: 5881 ggtaaacaagcaaaa 5867 >AE008861 AE006468 |AE008861| Salmonella typhimurium LT2, section 165 of 220 of the complete genome. Length = 20281 Score = 34.2 bits (17), Expect = 0.39 Identities = 17/17 (100%) Strand = Plus / Minus Query: 349 gttgaccgtatcgtcgg 365 ||||||||||||||||| Sbjct: 3737 gttgaccgtatcgtcgg 3721 >AE008915 AE006468 |AE008915| Salmonella typhimurium LT2, section 219 of 220 of the complete genome. Length = 21405 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 285 gatgaaagaagcgggc 300 |||||||||||||||| Sbjct: 2336 gatgaaagaagcgggc 2351 >AE008808 AE006468 |AE008808| Salmonella typhimurium LT2, section 112 of 220 of the complete genome. Length = 22929 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 86 tctccactggcgatat 101 |||||||||||||||| Sbjct: 12910 tctccactggcgatat 12925 >AE008746 AE006468 |AE008746| Salmonella typhimurium LT2, section 50 of 220 of the complete genome. Length = 22288 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 165 tggcaaactggtcacc 180 |||||||||||||||| Sbjct: 5911 tggcaaactggtcacc 5926 >AE008735 AE006468 |AE008735| Salmonella typhimurium LT2, section 43 of 220 of the complete genome. Length = 21697 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 189 ggtgatcgcgctggtt 204 |||||||||||||||| Sbjct: 14839 ggtgatcgcgctggtt 14854 >AE012375 AE008922 |AE012375| Xanthomonas campestris pv. campestris str. ATCC 33913, section 283 of 460 of the complete genome. Length = 11056 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Plus Query: 607 gctgaagttcgcgctg 622 |||||||||||||||| Sbjct: 3403 gctgaagttcgcgctg 3418 >AE012208 AE008922 |AE012208| Xanthomonas campestris pv. campestris str. ATCC 33913, section 116 of 460 of the complete genome. Length = 10029 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%) Strand = Plus / Minus Query: 20 gcgctccgggcgcggg 35 |||||||||||||||| Sbjct: 5986 gcgctccgggcgcggg 5971 >embl|AE006111|AE006111 Pasteurella multocida subsp. multocida str. Pm70 section 78 of 204 of the complete genome. Length = 10062 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 620 ctgatctggaaaaaa 634 ||||||||||||||| Sbjct: 4171 ctgatctggaaaaaa 4185 >embl|AE006109|AE006109 Pasteurella multocida subsp. multocida str. Pm70 section 76 of 204 of the complete genome. Length = 13603 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 140 aacaagcaaaagaca 154 ||||||||||||||| Sbjct: 7829 aacaagcaaaagaca 7815 >embl|AE006104|AE006104 Pasteurella multocida subsp. multocida str. Pm70 section 71 of 204 of the complete genome. Length = 10192 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 609 tgaagttcgcgctga 623 ||||||||||||||| Sbjct: 729 tgaagttcgcgctga 715 >embl|AE006066|AE006066 Pasteurella multocida subsp. multocida str. Pm70 section 33 of 204 of the complete genome. Length = 11017 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 293 aagcgggcatcaatg 307 ||||||||||||||| Sbjct: 8288 aagcgggcatcaatg 8274 >AE008912 AE006468 |AE008912| Salmonella typhimurium LT2, section 216 of 220 of the complete genome. Length = 20216 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 433 aaagacgacgttacc 447 ||||||||||||||| Sbjct: 6060 aaagacgacgttacc 6074 >AE008858 AE006468 |AE008858| Salmonella typhimurium LT2, section 162 of 220 of the complete genome. Length = 20646 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 448 ggtgaagaactgact 462 ||||||||||||||| Sbjct: 9487 ggtgaagaactgact 9473 >AE008851 AE006468 |AE008851| Salmonella typhimurium LT2, section 155 of 220 of the complete genome. Length = 20120 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 298 ggcatcaatgttgat 312 ||||||||||||||| Sbjct: 15950 ggcatcaatgttgat 15936 >AE008850 AE006468 |AE008850| Salmonella typhimurium LT2, section 154 of 220 of the complete genome. Length = 21944 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 212 gcattgctcaggaag 226 ||||||||||||||| Sbjct: 6708 gcattgctcaggaag 6722 >AE008800 AE006468 |AE008800| Salmonella typhimurium LT2, section 104 of 220 of the complete genome. Length = 22908 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 238 ggtttcctgttggac 252 ||||||||||||||| Sbjct: 682 ggtttcctgttggac 696 >AE008794 AE006468 |AE008794| Salmonella typhimurium LT2, section 98 of 220 of the complete genome. Length = 26591 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 199 ctggttaaagagcgc 213 ||||||||||||||| Sbjct: 20406 ctggttaaagagcgc 20392 >AE008765 AE006468 |AE008765| Salmonella typhimurium LT2, section 69 of 220 of the complete genome. Length = 21585 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 438 cgacgttaccggtga 452 ||||||||||||||| Sbjct: 9294 cgacgttaccggtga 9308 >AE008724 AE006468 |AE008724| Salmonella typhimurium LT2, section 32 of 220 of the complete genome. Length = 26720 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 189 ggtgatcgcgctggt 203 ||||||||||||||| Sbjct: 607 ggtgatcgcgctggt 621 >AE012549 AE008922 |AE012549| Xanthomonas campestris pv. campestris str. ATCC 33913, section 457 of 460 of the complete genome. Length = 11227 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 170 aactggtcaccgacg 184 ||||||||||||||| Sbjct: 10763 aactggtcaccgacg 10749 >AE012530 AE008922 |AE012530| Xanthomonas campestris pv. campestris str. ATCC 33913, section 438 of 460 of the complete genome. Length = 9597 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 189 ggtgatcgcgctggt 203 ||||||||||||||| Sbjct: 3535 ggtgatcgcgctggt 3521 >AE012523 AE008922 |AE012523| Xanthomonas campestris pv. campestris str. ATCC 33913, section 431 of 460 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 187 ctggtgatcgcgctg 201 ||||||||||||||| Sbjct: 1608 ctggtgatcgcgctg 1622 >AE012516 AE008922 |AE012516| Xanthomonas campestris pv. campestris str. ATCC 33913, section 424 of 460 of the complete genome. Length = 10866 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 526 gcaccgctgatcggc 540 ||||||||||||||| Sbjct: 6395 gcaccgctgatcggc 6381 >AE012411 AE008922 |AE012411| Xanthomonas campestris pv. campestris str. ATCC 33913, section 319 of 460 of the complete genome. Length = 11819 Score = 30.2 bits (15), Expect = 6.1 Identities = 18/19 (94%) Strand = Plus / Plus Query: 607 gctgaagttcgcgctgatc 625 ||||| ||||||||||||| Sbjct: 4287 gctgatgttcgcgctgatc 4305 >AE012388 AE008922 |AE012388| Xanthomonas campestris pv. campestris str. ATCC 33913, section 296 of 460 of the complete genome. Length = 10043 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 271 ccgcaggcagacgcg 285 ||||||||||||||| Sbjct: 5587 ccgcaggcagacgcg 5601 >AE012363 AE008922 |AE012363| Xanthomonas campestris pv. campestris str. ATCC 33913, section 271 of 460 of the complete genome. Length = 8145 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 187 ctggtgatcgcgctg 201 ||||||||||||||| Sbjct: 2591 ctggtgatcgcgctg 2577 >AE012281 AE008922 |AE012281| Xanthomonas campestris pv. campestris str. ATCC 33913, section 189 of 460 of the complete genome. Length = 14692 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 245 tgttggacggcttcc 259 ||||||||||||||| Sbjct: 1161 tgttggacggcttcc 1175 >AE012119 AE008922 |AE012119| Xanthomonas campestris pv. campestris str. ATCC 33913, section 27 of 460 of the complete genome. Length = 10950 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Plus Query: 591 cggcaccaagccggt 605 ||||||||||||||| Sbjct: 1531 cggcaccaagccggt 1545 >AE012111 AE008922 |AE012111| Xanthomonas campestris pv. campestris str. ATCC 33913, section 19 of 460 of the complete genome. Length = 11732 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 441 cgttaccggtgaaga 455 ||||||||||||||| Sbjct: 901 cgttaccggtgaaga 887 >AE012100 AE008922 |AE012100| Xanthomonas campestris pv. campestris str. ATCC 33913, section 8 of 460 of the complete genome. Length = 10180 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 284 cgatgaaagaagcgg 298 ||||||||||||||| Sbjct: 4830 cgatgaaagaagcgg 4816 >AE012099 AE008922 |AE012099| Xanthomonas campestris pv. campestris str. ATCC 33913, section 7 of 460 of the complete genome. Length = 10647 Score = 30.2 bits (15), Expect = 6.1 Identities = 15/15 (100%) Strand = Plus / Minus Query: 189 ggtgatcgcgctggt 203 ||||||||||||||| Sbjct: 177 ggtgatcgcgctggt 163 Database: 3gen Posted date: Dec 2, 2007 5:04 PM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 89,437 Number of extensions: 5176 Number of successful extensions: 40 Number of sequences better than 10.0: 35 Number of HSP's gapped: 38 Number of HSP's successfully gapped: 38 Length of query: 645 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 628 Effective length of database: 12,228,859 Effective search space: 7679723452 Effective search space used: 7679723452 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 15 (30.2 bits)