RID: M0H9SUGK114 Job Title:gb|CP001161.1| Program: BLASTN Query: Buchnera aphidicola str. 5A (Acyrthosiphon pisum), complete genome ID: CP001161.1(nucleic acid) Length: 642122 Subject:NODE_11_length_1803_cov_216.754303 ID: lcl|Query_2907213(dna) Length: 1829 Sequences producing significant alignments: Scientific Common Max Total Query E Per. Acc. Description Name Name Taxid Score Score cover Value Ident Len Accession NODE_11_length_1803_cov_216.754303 0 38.3 220 0% 0.007 84.85 1829 Query_2907213 Alignments: >NODE_11_length_1803_cov_216.754303 Sequence ID: Query_2907213 Length: 1829 Range 1: 1547 to 1579 Score:38.3 bits(41), Expect:0.007, Identities:28/33(85%), Gaps:0/33(0%), Strand: Plus/Minus Query 379374 ATAAGAAATTAAAATTTTTAGAAAAAGACATAA 379406 |||| ||| |||||||||| |||||| ||| || Sbjct 1579 ATAAAAAAATAAAATTTTTTGAAAAAAACAAAA 1547 Range 2: 889 to 908 Score:37.4 bits(40), Expect:0.007, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Minus Query 270505 TTAAAATATGATGaaaaaaa 270524 |||||||||||||||||||| Sbjct 908 TTAAAATATGATGAAAAAAA 889 Range 3: 1547 to 1576 Score:37.4 bits(40), Expect:0.007, Identities:26/30(87%), Gaps:0/30(0%), Strand: Plus/Plus Query 64251 tttttttATTTTCAGAAAATTTTATTATTT 64280 |||| || |||||| ||||||||||| ||| Sbjct 1547 TTTTGTTTTTTTCAAAAAATTTTATTTTTT 1576 Range 4: 1185 to 1222 Score:36.5 bits(39), Expect:0.023, Identities:32/39(82%), Gaps:1/39(2%), Strand: Plus/Plus Query 190684 TTCCAAttttttttGTCATTCTTCTGTTATGTTTTTTaa 190722 ||||| ||| |||| | |||||||||| | |||||||| Sbjct 1185 TTCCAGTTTCTTTTCTATTTCTTCTGTTCT-TTTTTTAA 1222 Range 5: 1060 to 1098 Score:35.6 bits(38), Expect:0.023, Identities:31/39(79%), Gaps:0/39(0%), Strand: Plus/Minus Query 312535 aaaaaaaaTATCTCTACAATTAATTCAAAAATGTGACAT 312573 || ||||| || | | |||||||||||||| |||| || Sbjct 1098 AATAAAAAAATTACAAAAATTAATTCAAAAAGGTGAAAT 1060 Range 6: 1215 to 1233 Score:35.6 bits(38), Expect:0.023, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus Query 536697 AAAAAATAGAATTAAAAAA 536715 ||||||||||||||||||| Sbjct 1233 AAAAAATAGAATTAAAAAA 1215