BLASTN 2.2.10 [Oct-19-2004]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
         (77 letters)

Database: bs 
           1 sequences; 4,214,630 total letters

Searching.done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosom...   103   2e-23

>AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosome,
             complete sequence.
          Length = 4214630

 Score =  103 bits (52), Expect = 2e-23
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                         
Query: 6     tgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaagtccac 65
             |||||||||| |||||||||||||| ||||||||| |||||||||||||||| |||||||
Sbjct: 31935 tgtagctcagctggttagagcgcacgcctgataagcgtgaggtcggtggttcgagtccac 31994

                         
Query: 66    tcaggcctacca 77
             ||||||| ||||
Sbjct: 31995 tcaggcccacca 32006



 Score =  103 bits (52), Expect = 2e-23
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                         
Query: 6     tgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaagtccac 65
             |||||||||| |||||||||||||| ||||||||| |||||||||||||||| |||||||
Sbjct: 11467 tgtagctcagctggttagagcgcacgcctgataagcgtgaggtcggtggttcgagtccac 11526

                         
Query: 66    tcaggcctacca 77
             ||||||| ||||
Sbjct: 11527 tcaggcccacca 11538



 Score = 87.7 bits (44), Expect = 1e-18
 Identities = 65/72 (90%)
 Strand = Plus / Minus

                                                                           
Query: 6       tgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaagtccac 65
               |||||||||| |||||||||||||| ||||||||| ||||||||| |||||| |||||| 
Sbjct: 3171273 tgtagctcagctggttagagcgcacgcctgataagcgtgaggtcgatggttcgagtccat 3171214

                           
Query: 66      tcaggcctacca 77
               ||||||| ||||
Sbjct: 3171213 tcaggcccacca 3171202


  Database: bs
    Posted date:  Oct 1, 2006  8:51 PM
  Number of letters in database: 4,214,630
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 50
Number of Sequences: 1
Number of extensions: 50
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 3
length of query: 77
length of database: 4,214,630
effective HSP length: 14
effective length of query: 63
effective length of database: 4,214,616
effective search space: 265520808
effective search space used: 265520808
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)