BLASTN 2.2.10 [Oct-19-2004]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= EMBOSS_001
(1344 letters)
Database: 3g1
1077 sequences; 12,619,654 total letters
Searching...done
Score E
Sequences producing significant alignments: (bits) Value
embl|AE006120|AE006120 Pasteurella multocida subsp. multocida st... 70 2e-11
embl|AE006134|AE006134 Pasteurella multocida subsp. multocida st... 36 0.22
embl|AE004534|AE004534 Pseudomonas aeruginosa PAO1, section 95 o... 36 0.22
embl|AE004330|AE004330 Vibrio cholerae O1 biovar eltor str. N169... 36 0.22
embl|AE004676|AE004676 Pseudomonas aeruginosa PAO1, section 237 ... 34 0.85
embl|AE006203|AE006203 Pasteurella multocida subsp. multocida st... 32 3.4
embl|AE006179|AE006179 Pasteurella multocida subsp. multocida st... 32 3.4
embl|AE004966|AE004966 Pseudomonas aeruginosa PAO1, section 527 ... 32 3.4
embl|AE004898|AE004898 Pseudomonas aeruginosa PAO1, section 459 ... 32 3.4
embl|AE004776|AE004776 Pseudomonas aeruginosa PAO1, section 337 ... 32 3.4
embl|AE004520|AE004520 Pseudomonas aeruginosa PAO1, section 81 o... 32 3.4
embl|AE004517|AE004517 Pseudomonas aeruginosa PAO1, section 78 o... 32 3.4
>embl|AE006120|AE006120 Pasteurella multocida subsp. multocida str.
Pm70 section 87 of 204 of the complete genome.
Length = 11573
Score = 69.9 bits (35), Expect = 2e-11
Identities = 65/75 (86%)
Strand = Plus / Minus
Query: 358 gaagatggcgtgaatatctggggtgacggtagcacctacaaaggaaacgatatcgaacgt 417
||||||| ||||||||||||||||| || || |||| |||||| || ||||| || |||
Sbjct: 3240 gaagatgatgtgaatatctggggtgatggcagtaccttcaaaggtaatgatattgagcgt 3181
Query: 418 ttctatcgttatggt 432
|||||||||||||||
Sbjct: 3180 ttctatcgttatggt 3166
Score = 56.0 bits (28), Expect = 2e-07
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 43 ggtatcgctttttctggcggtctggacaccagtgccgcactgctgtggatgcgacaaaag 102
|||||||| ||||| || ||| | || |||||||| ||| || | |||||||| |||||
Sbjct: 3555 ggtatcgcgttttcaggtggtttagataccagtgcagcattgttatggatgcgtcaaaaa 3496
Query: 103 ggagcggttccttatgcatatactgcaaacctgggccagccagacgaagaggatta 158
|| || ||||||||||| ||||| || ||| | || || ||||| |||||||||||
Sbjct: 3495 ggggctgttccttatgcctataccgcgaacttaggtcaaccagatgaagaggatta 3440
Score = 54.0 bits (27), Expect = 9e-07
Identities = 66/79 (83%)
Strand = Plus / Minus
Query: 547 tacaaaatgtctgtcgaaaaagcctactccacagactccaacatgcttggtgcaacgcat 606
||||||||||| || ||||||||||| || ||||| || || ||||| ||||| || |||
Sbjct: 3051 tacaaaatgtcagtggaaaaagcctattcaacagattcaaatatgctaggtgccacccat 2992
Query: 607 gaagcgaaggatctggaat 625
||||| || ||||| ||||
Sbjct: 2991 gaagccaaagatcttgaat 2973
Score = 42.1 bits (21), Expect = 0.003
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 829 gaccagattgaaaaccgtatcatcgaagcgaaaagccgtggtatttacgaagctccgggg 888
||||| ||||||||||| || || ||||| ||| ||||||||||| || || ||||||
Sbjct: 2769 gaccaaattgaaaaccgaattattgaagccaaatcgcgtggtatttatgaggcaccgggg 2710
Query: 889 atggc 893
|||||
Sbjct: 2709 atggc 2705
Score = 40.1 bits (20), Expect = 0.014
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 1197 tgatcgtattggtcaattgaccatgcgtaacctggatatc 1236
|||||||||||||||||| || ||||| ||| | ||||||
Sbjct: 2398 tgatcgtattggtcaattaacgatgcgcaacttagatatc 2359
Score = 32.2 bits (16), Expect = 3.4
Identities = 22/24 (91%)
Strand = Plus / Minus
Query: 703 gaagaagtcacagtacgctttgaa 726
||||||||||| || |||||||||
Sbjct: 2895 gaagaagtcactgtgcgctttgaa 2872
>embl|AE006134|AE006134 Pasteurella multocida subsp. multocida str.
Pm70 section 101 of 204 of the complete genome.
Length = 11667
Score = 36.2 bits (18), Expect = 0.22
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 712 acagtacgctttgaacaa 729
||||||||||||||||||
Sbjct: 9981 acagtacgctttgaacaa 9964
>embl|AE004534|AE004534 Pseudomonas aeruginosa PAO1, section 95 of 529
of the complete genome.
Length = 14148
Score = 36.2 bits (18), Expect = 0.22
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 813 cggcctgggcatgagcga 830
||||||||||||||||||
Sbjct: 9356 cggcctgggcatgagcga 9373
>embl|AE004330|AE004330 Vibrio cholerae O1 biovar eltor str. N16961
chromosome I, section 238 of 251 of the complete
chromosome.
Length = 11523
Score = 36.2 bits (18), Expect = 0.22
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 54 ttctggcggtctggacac 71
||||||||||||||||||
Sbjct: 9483 ttctggcggtctggacac 9466
>embl|AE004676|AE004676 Pseudomonas aeruginosa PAO1, section 237 of 529
of the complete genome.
Length = 14928
Score = 34.2 bits (17), Expect = 0.85
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1048 cgctgggttgccagcca 1064
|||||||||||||||||
Sbjct: 14816 cgctgggttgccagcca 14800
>embl|AE006203|AE006203 Pasteurella multocida subsp. multocida str. Pm70
section 170 of 204 of the complete genome.
Length = 10697
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 721 tttgaacaaggtcatc 736
||||||||||||||||
Sbjct: 10116 tttgaacaaggtcatc 10131
>embl|AE006179|AE006179 Pasteurella multocida subsp. multocida str.
Pm70 section 146 of 204 of the complete genome.
Length = 11375
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 34 caacgtattggtatcg 49
||||||||||||||||
Sbjct: 1310 caacgtattggtatcg 1325
>embl|AE004966|AE004966 Pseudomonas aeruginosa PAO1, section 527 of
529 of the complete genome.
Length = 10821
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 56 ctggcggtctggacac 71
||||||||||||||||
Sbjct: 655 ctggcggtctggacac 640
>embl|AE004898|AE004898 Pseudomonas aeruginosa PAO1, section 459 of
529 of the complete genome.
Length = 10927
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 281 ccggcggcctgaccta 296
||||||||||||||||
Sbjct: 9732 ccggcggcctgaccta 9747
>embl|AE004776|AE004776 Pseudomonas aeruginosa PAO1, section 337 of
529 of the complete genome.
Length = 11673
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 309 gccgctgggccgcgcc 324
||||||||||||||||
Sbjct: 9975 gccgctgggccgcgcc 9990
>embl|AE004520|AE004520 Pseudomonas aeruginosa PAO1, section 81 of 529
of the complete genome.
Length = 12217
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 378 gggtgacggtagcacc 393
||||||||||||||||
Sbjct: 3332 gggtgacggtagcacc 3347
>embl|AE004517|AE004517 Pseudomonas aeruginosa PAO1, section 78 of
529 of the complete genome.
Length = 10822
Score = 32.2 bits (16), Expect = 3.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 226 caactggtggccgaag 241
||||||||||||||||
Sbjct: 221 caactggtggccgaag 206
Database: 3g1
Posted date: Oct 2, 2006 2:39 AM
Number of letters in database: 12,619,654
Number of sequences in database: 1077
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 10,738
Number of Sequences: 1077
Number of extensions: 10738
Number of successful extensions: 17
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 17
length of query: 1344
length of database: 12,619,654
effective HSP length: 17
effective length of query: 1327
effective length of database: 12,601,345
effective search space: 16721984815
effective search space used: 16721984815
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)
|